ncbi logo		 UniSTS logo
 PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure
  Search for

Entrez UniSTS
Help
Query tips
Submit
Submit map
FTP site
Statistics

Related sites
e-PCR
Map Viewer
Gene
UniGene
dbSNP
GeneMap'99
MGD
ZFIN

Genomic biology
Bos taurus
Canis familiaris
Danio rerio
Homo sapiens
Mus musculus
Rattus novegicus
Sus scrofa

UniSTS:50887 Links
D8S1469
Homo sapiens chromosome 8, polymorphic
Pan troglodytes chromosome 8

Found by e-PCR in sequences from Homo sapiens and Pan troglodytes.

Primer InformationHelp

Forward primer:GCTTTAGAAGGCGGAGGTAG
Reverse primer:GAGGGGGTTAAAGGTGTCAT
PCR product size:218-230 (bp), Homo sapiens
GenBank Accession:G08702

   Homo sapiens
Name: D8S1469
Also known as: CHLC.GATA67F10 CHLC.GATA67F10.P18587 G00-455-873 GATA-P18587 GATA67F10 GDB:685440 SHGC-18043
Polymorphism info: on genetic map

Cross References Help

Mapping InformationHelp
D8S1469 Sequence Map: Chr 8|HuRef Map Viewer
  Position: 8014685-8014909 (bp)
 
D8S1469 Sequence Map: Chr 8|Celera Map Viewer
  Position: 8217944-8218168 (bp)
 
D8S1469 Sequence Map: Chr 8 Map Viewer
  Position: 9127124-9127348 (bp)
 
GATA67F10 Marshfield Map: Chr 8 Map Viewer
  Position: 16.19 (cM)
 
CHLC.GATA67F10 NCBI RH Map: Chr 8 Map Viewer
  Position: 80 (cR)
  Lod score: 1.21
 
SHGC-18043 TNG Map: Chr 8 Map Viewer
  Position: 4962 (cR50000)
  Lod score: 0
  Reference Interval: 9
 
CHLC.GATA67F10 Whitehead-RH Map: Chr 8 Map Viewer
  Position: 42.9 (cR3000)
  Lod score: P1.42
 
CHLC.GATA67F10 Whitehead-YAC Map: Chr 8 Map Viewer
  Reference Interval: WC8.1

Electronic PCR results Help
Genomic (5 of 9)[Show All Hits]
G08702.1 167 .. 387 (221 bp)  
AC022784.7 87208 .. 87432 (225 bp)  
AC021736.9 155073 .. 155293 (221 bp)  
CH003455.1 8125312 .. 8125536 (225 bp)  
CH003503.1 8693691 .. 8693915 (225 bp)  
 
Working Draft phase 1 (from GenBank HTGS division) (1)
AC022831.4 6730 .. 6950 (221 bp)  
 
Whole Genome Shotgun sequences (5)
AADD01088701.1 47 .. 271 (225 bp)  
AADC01073336.1 26272 .. 26496 (225 bp)  
AADB02011009.1 835660 .. 835884 (225 bp)  
ABBA01099773.1 561 .. 785 (225 bp)  
ABBA01026908.1 35889 .. 36113 (225 bp)  
 

   Pan troglodytes
Name: D8S1469
Polymorphism info:  
Mapping InformationHelp
D8S1469 Sequence Map: Chr 8|NW_001240294.1 Map Viewer
  Position: 1094489-1094709 (bp)

Electronic PCR results Help
Genomic (1)
CH702961.1 1094489 .. 1094709 (221 bp)  
 
Whole Genome Shotgun sequences (2)
AADA01317578.1 4050 .. 4270 (221 bp)  
AACZ02101407.1 19202 .. 19422 (221 bp)  
 

 

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement