PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure

Search Entrez NCBI Web site ------------- Books CloneRegistry Domains 3D Domains Gene Genome GEO GEO Datasets HomoloGene Journals MapViewer MeSH Nucleotide OMIM PMC PopSet Protein PubMed SNP Structure Taxonomy UniGene UniSTS for

Entrez UniSTS Help Query tips Submit Submit map FTP site Statistics Related sites e-PCR Map Viewer Gene UniGene dbSNP GeneMap'99 MGD ZFIN Genomic biology Bos taurus Canis familiaris Danio rerio Homo sapiens Mus musculus Rattus novegicus Sus scrofa

UniSTS:59271 Links D11S4634 Homo sapiens chromosome 11, locus DLG2 Pan troglodytes chromosome 11, locus DLG2 Found by e-PCR in sequences from Homo sapiens and Pan troglodytes. Primer Information Forward primer: GTTGAAACTGCAAAATACAGAAGC Reverse primer: AACAGAAACCAGTGGTTGCC PCR product size: 94 (bp), Homo sapiens GenBank Accession: G13753    Homo sapiens Name: D11S4634 Also known as: GDB:740414 SHGC-13230 Polymorphism info:   Cross References Gene GeneID: 1740   Symbol: DLG2   Description: discs, large homolog 2 (Drosophila)   Position: 11q14.1 Mapping Information D11S4634 Sequence Map: Chr 11|HuRef Map Viewer   Position: 79712579-79712672 (bp)   D11S4634 Sequence Map: Chr 11|Celera Map Viewer   Position: 80725008-80725101 (bp)   D11S4634 Sequence Map: Chr 11 Map Viewer   Position: 83093058-83093151 (bp)   SHGC-13230 NCBI RH Map: Chr 11 Map Viewer   Position: 671.6 (cR)   Lod score: 1.01   SHGC-13230 TNG Map: Chr 11 Map Viewer   Position: 37851 (cR50000)   Lod score: 6.1   Reference Interval: 101   SHGC-13230 Stanford-G3 Map: Chr 11 Map Viewer   Position: 3628 (cR10000)   Lod score: F   Reference Interval: 95 Electronic PCR results Genomic (5 of 9)[Show All Hits] G13753.1 178 .. 271 (94 bp)   AP000773.4 153864 .. 153957 (94 bp)   AP002370.5 59058 .. 59151 (94 bp)   CH003458.1 81909397 .. 81909490 (94 bp)   CH003506.1 83086814 .. 83086907 (94 bp)     Working Draft phase 1 (from GenBank HTGS division) (1) AC018708.5 54688 .. 54781 (94 bp)     Whole Genome Shotgun sequences (4) AADD01117715.1 31593 .. 31686 (94 bp)   AADC01100486.1 123638 .. 123731 (94 bp)   AADB02014298.1 5883542 .. 5883635 (94 bp)   ABBA01017353.1 32218 .. 32311 (94 bp)        Pan troglodytes Name: D11S4634 Polymorphism info:   Cross References Gene GeneID: 466728   Symbol: DLG2   Description: discs, large homolog 2, chapsyn-110 (Drosophila)   Position:   Mapping Information D11S4634 Sequence Map: Chr 11 Map Viewer   Position: 82285281-82285374 (bp) Electronic PCR results Genomic (1) CM000325.1 82285281 .. 82285374 (94 bp)     Whole Genome Shotgun sequences (2) AADA01213268.1 24060 .. 24153 (94 bp)   AACZ02126823.1 18210 .. 18303 (94 bp)

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement