refSNP ID: rs3027499 Organism: human (Homo sapiens) Molecule Type: Genomic Created/Updated in build: 102/129 Map to Genome Build: 36.3 Allele Variation Class: SNP: single nucleotide polymorphism RefSNP Alleles: A/G Ancestral Allele: A Clinical Association: unknown HGVS Names NM_017602.2:c.689-2811A>G NT_079573.3:g.11646869T>C Links , Linkout SNP Details are organized in the following sections: Submission Fasta Resource GeneView Map Diversity Validation   Submitter records for this RefSNP Cluster The submission ss4258442 has the longest flanking sequence of all cluster members and was used to instantiate sequence for rs3027499 during BLAST analysis for the current build. NCBI Assay ID Handle|Submitter ID Validation Status ss to rs Orientation /Strand Alleles 5' Near Seq 30 bp 3' Near Seq 30 bp Entry Date Update Date Build Added Molecule Type Freq Warning Ancestral Allele Success Rate ss4258442 ACEVAN|ABACUS5516 fwd/T A/G tatggcaacattctggctgactcgtgggta ctagcatatgaaggaatcattgtcgtcatg 11/07/01 10/10/03 102 Genomic unknown ss74993790 ILLUMINA|ILMN_Human_1M_rs3027499 fwd/T A/G tatggcaacattctggctgactcgtgggta ctagcatatgaaggaatcattgtcgtcatg 08/28/07 08/29/07 129 Genomic unknown   Fasta sequence   (Legend) >gnl|dbSNP|rs3027499|allelePos=51|totalLen=101|taxid=9606|snpclass=1|alleles='A/G'|mol=Genomic|build=129 GGAAGGGCTT CATAAGTGGT TATGGCAACA TTCTGGCTGA CTCGTGGGTA R CTAGCATATG AAGGAATCAT TGTCGTCATG ACAAATTGTG TTCCTGTTTC   GeneView GeneView via analysis of contig annotation: OTUD5 OTU domain containing 5 View variations for gene: Include clinically associated: in gene region cSNP has frequency double hit Group Label Contig->mRNA Gene Model (contig mRNA transcript) Color Legend reference NT_079573->NM_017602 sv function HuRef NW_001842363->NM_017602 sv function Celera NW_927703->NM_017602 sv function " Group label Contig-->mRNA-->Protein Contig position mRNA orientation mRNA pos Function dbSNP allele Protein residue Codon pos Amino acid pos reference NT_079573->NM_017602->NP_060072 11646869 reverse intron HuRef NW_001842363->NM_017602->NP_060072 501319 reverse intron Celera NW_927703->NM_017602->NP_060072 378671 forward intron GeneView: no link established by BLAST analysis of mRNA sequences   Integrated Maps: NCBI MapViewer:  rs3027499 maps exactly once on NCBI human chromosome X Chromosome Contig accession Contig position Chromosome position Hit orientation Contig Allele Assembly Type Group label Contig label Neighbor SNP SNP_flank position X NW_001842363.1 501319 46451512 minus T alt_assembly_8 HuRef HuRef view 50 X NT_079573.3 11646869 48680046 minus T ref_assembly reference reference view 50 X NW_927703.1 378671 52868427 plus A alt_assembly_1 Celera Celera view 50   NCBI Resource Links Submitter-Referenced GenBank NT001216_033 dbSNP Blast Analysis GenBank HTGS Finished: AF207550.3 NC_000023.9   Population Diversity There is no frequency data.   Validation Summary: Validation status Marker displays Mendelian segregation PCR results confirmed in multiple reactions Homozygotes detected in individual genotype data UNKNOWN UNKNOWN YES

GENERAL: Contact Us | Homepage | Announcements |dbSNP Summary | Genome | FTP SERVER | Build History | Handle Request
DOCUMENTATION: FAQ | Searchable FAQ Archive | Overview | How to Submit | RefSNP Summary Info | Database Schema
SEARCH: Entrez SNP | Blast SNP | Batch Query | By Submitter |New Batches | Method | Population | Publication | Batch | Locus Info | Between Marker
HAPLOTYPE:Submission | Specifications | Sample HapSet | Sample Individual
NCBI: PubMed | Entrez | BLAST | OMIM | Taxonomy | Structure

Disclaimer     Privacy statement

Revised: May 25, 2006 1:38 PM .