refSNP ID: rs1065372 Organism: human (Homo sapiens) Molecule Type: cDNA Created/Updated in build: 86/129 Map to Genome Build: 36.3 Allele Variation Class: SNP: single nucleotide polymorphism RefSNP Alleles: C/G Ancestral Allele: G Clinical Association: unknown HGVS Names NM_003028.2:c.271G>C NP_003019.2:p.D91H NT_008413.17:g.38058371C>G Links , Linkout SNP Details are organized in the following sections: Submission Fasta Resource GeneView Map Diversity Validation   Submitter records for this RefSNP Cluster The submission ss1555533 has the longest flanking sequence of all cluster members and was used to instantiate sequence for rs1065372 during BLAST analysis for the current build. NCBI Assay ID Handle|Submitter ID Validation Status ss to rs Orientation /Strand Alleles 5' Near Seq 30 bp 3' Near Seq 30 bp Entry Date Update Date Build Added Molecule Type Freq Warning Ancestral Allele Success Rate ss1555533 LEE|1462078 fwd/B C/G atccgcgcctaccgcgcgcagaaggagcga acttcgaggacccctacaacgggcctggct 09/13/00 10/10/03 86 cDNA unknown   Fasta sequence   (Legend) >gnl|dbSNP|rs1065372|allelePos=51|totalLen=101|taxid=9606|snpclass=1|alleles='C/G'|mol=cDNA|build=86 GCGGCAGCAC CAGCGACCTC ATCCGCGCCT ACCGCGCGCA GAAGGAGCGA S ACTTCGAGGA CCCCTACAAC GGGCCTGGCT CGTCGCTGCG CAAACTGCGC   GeneView GeneView via analysis of contig annotation: SHB Src homology 2 domain containing adaptor protein B View variations for gene: Include clinically associated: in gene region cSNP has frequency double hit Group Label Contig->mRNA Gene Model (contig mRNA transcript) Color Legend reference NT_008413->NM_003028 sv function HuRef NW_001839151->NM_003028 sv function Celera NW_924062->NM_003028 sv function " Group label Contig-->mRNA-->Protein Contig position mRNA orientation mRNA pos Function dbSNP allele Protein residue Codon pos Amino acid pos reference NT_008413->NM_003028->NP_003019 38058372 reverse 839 missense C His [H] 1 91 contig reference G Asp [D] 1 91 HuRef NW_001839151->NM_003028->NP_003019 718343 forward 839 missense C His [H] 1 91 contig reference G Asp [D] 1 91 Celera NW_924062->NM_003028->NP_003019 37886061 reverse 839 missense C His [H] 1 91 contig reference G Asp [D] 1 91 GeneView: no link established by BLAST analysis of mRNA sequences   Integrated Maps: NCBI MapViewer:  rs1065372 maps exactly once on NCBI human chromosome 9 Chromosome Contig accession Contig position Chromosome position Hit orientation Contig Allele Assembly Type Group label Contig label Neighbor SNP SNP_flank position 9 NW_924062.1 37886061 38001542 minus C alt_assembly_1 Celera Celera view 50 9 NW_001839151.2 718343 38020756 plus G alt_assembly_8 HuRef HuRef view 50 9 NT_008413.17 38058372 38058372 minus C ref_assembly reference reference view 50   NCBI Resource Links Submitter-Referenced GenBank X75342 Hs.244542 dbSNP Blast Analysis UniGene Cluster ID 521482   Population Diversity Sample Ascertainment Genotypes Alleles ss# Population Individual Group Chrom. Sample Cnt. Source HWP C G ss1555533 CEPH 184 AF 1.000 Summary Average Het.+/- std err: Individual Count Founders Count Individual Overlap Genotype Conflict 0 0 0 0   Validation Summary: Validation status Marker displays Mendelian segregation PCR results confirmed in multiple reactions Homozygotes detected in individual genotype data UNKNOWN UNKNOWN UNKNOWN

GENERAL: Contact Us | Homepage | Announcements |dbSNP Summary | Genome | FTP SERVER | Build History | Handle Request
DOCUMENTATION: FAQ | Searchable FAQ Archive | Overview | How to Submit | RefSNP Summary Info | Database Schema
SEARCH: Entrez SNP | Blast SNP | Batch Query | By Submitter |New Batches | Method | Population | Publication | Batch | Locus Info | Between Marker
HAPLOTYPE:Submission | Specifications | Sample HapSet | Sample Individual
NCBI: PubMed | Entrez | BLAST | OMIM | Taxonomy | Structure

Disclaimer     Privacy statement

Revised: May 25, 2006 1:38 PM .