PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure

Search Entrez NCBI Web site ------------- Books CloneRegistry Domains 3D Domains Gene Genome GEO GEO Datasets HomoloGene Journals MapViewer MeSH Nucleotide OMIM PMC PopSet Protein PubMed SNP Structure Taxonomy UniGene UniSTS for

Entrez UniSTS Help Query tips Submit Submit map FTP site Statistics Related sites e-PCR Map Viewer Gene UniGene dbSNP GeneMap'99 MGD ZFIN Genomic biology Bos taurus Canis familiaris Danio rerio Homo sapiens Mus musculus Rattus novegicus Sus scrofa

UniSTS:18687 Links SHGC-33433 Homo sapiens chromosome 15 Macaca mulatta chromosome 7 Pan troglodytes chromosome 15 Found by e-PCR in sequences from Homo sapiens and Pan troglodytes. Primer Information Forward primer: ATCCTTACAACAGGCAATATGATC Reverse primer: GGGCCACACTGCAGTCAAG PCR product size: 150 (bp), Homo sapiens GenBank Accession: G24839 G29431 T70270    Homo sapiens Name: SHGC-33433 Also known as: EST131190 SGC33433 Polymorphism info:   Cross References UniGene Hs.633022 Transcribed locus Mapping Information SHGC-33433 Sequence Map: Chr 15|HuRef Map Viewer   Position: 62360470-62360618 (bp)   SHGC-33433 Sequence Map: Chr 15|Celera Map Viewer   Position: 62698000-62698148 (bp)   SHGC-33433 Sequence Map: Chr 15 Map Viewer   Position: 84099176-84099324 (bp)   SHGC-33433 NCBI RH Map: Chr 15 Map Viewer   Position: 596.8 (cR)   Lod score: 3.40   SHGC-33433 Stanford-G3 Map: Chr 15 Map Viewer   Position: 3053 (cR10000)   Lod score: F   Reference Interval: 66   SGC33433 Whitehead-RH Map: Chr 15 Map Viewer   Position: 324.5 (cR3000)   Lod score: P1.32   SHGC-33433 GeneMap99-G3 Map: Chr 15 Map Viewer   Position: 3048 (cR10000)   Lod score: F   Reference Interval: D15S115-D15S152   SGC33433 GeneMap99-GB4 Map: Chr 15 Map Viewer   Position: 306.78 (cR3000)   Lod score: 1.05   Reference Interval: D15S152-D15S151 Electronic PCR results Genomic (5 of 9)[Show All Hits] G24839.1 1 .. 150 (150 bp)   G29431.1 1 .. 150 (150 bp)   AC021739.16 63471 .. 63619 (149 bp)   CH003462.1 62228132 .. 62228280 (149 bp)   CH003510.1 66062255 .. 66062403 (149 bp)     Working Draft phase 1 (from GenBank HTGS division) (3) AC007897.4 8155 .. 8303 (149 bp)   AC026840.4 3114 .. 3262 (149 bp)   AC068402.2 48676 .. 48824 (149 bp)     Low-pass Sequence Sampling (from GenBank HTGS division) (1) AC044822.1 22007 .. 22155 (149 bp)     ESTs (1) T70270.1 1 .. 150 (150 bp)     Whole Genome Shotgun sequences (4) AADD01145424.1 15747 .. 15895 (149 bp)   AADC01122836.1 83467 .. 83615 (149 bp)   AADB02016837.1 110332 .. 110480 (149 bp)   ABBA01052968.1 16662 .. 16810 (149 bp)        Macaca mulatta Name: SHGC-33433 Polymorphism info:   Mapping Information SHGC-33433 Sequence Map: Chr 7 Map Viewer   Position: 65356834-65356985 (bp)    Pan troglodytes Name: SHGC-33433 Polymorphism info:   Mapping Information SHGC-33433 Sequence Map: Chr 15 Map Viewer   Position: 83400842-83400990 (bp) Electronic PCR results Genomic (1) CM000329.1 83400842 .. 83400990 (149 bp)     Whole Genome Shotgun sequences (2) AADA01010445.1 9684 .. 9832 (149 bp)   AACZ02157238.1 48086 .. 48234 (149 bp)

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement