refSNP ID: rs2285514 Organism: human (Homo sapiens) Molecule Type: Genomic Created/Updated in build: 100/129 Map to Genome Build: 36.3 Allele Variation Class: SNP: single nucleotide polymorphism RefSNP Alleles: A/G Ancestral Allele: G Clinical Association: unknown HGVS Names NM_014364.4:c.328G>A NP_055179.1:p.D110N NT_011109.15:g.8297508G>A Links , Linkout SNP Details are organized in the following sections: Submission Fasta Resource GeneView Map Diversity Validation   Submitter records for this RefSNP Cluster The submission ss3225656 has the longest flanking sequence of all cluster members and was used to instantiate sequence for rs2285514 during BLAST analysis for the current build. NCBI Assay ID Handle|Submitter ID Validation Status ss to rs Orientation /Strand Alleles 5' Near Seq 30 bp 3' Near Seq 30 bp Entry Date Update Date Build Added Molecule Type Freq Warning Ancestral Allele Success Rate ss3225656 YUSUKE|IMS-JST035740 fwd/T A/G aaggtggtggctgtgaatgatccattcatt acccggaatacatggtcagtagctggcaga 09/05/01 08/14/07 100 Genomic unknown ss74819160 AFFY|SNP_M-320026 fwd/T A/G aaggtggtggctgtgaatgatccattcatt acccggaatacatggtcagtagctggcaga 08/09/07 08/09/07 128 Genomic unknown   Fasta sequence   (Legend) >gnl|dbSNP|rs2285514|allelePos=61|totalLen=121|taxid=9606|snpclass=1|alleles='A/G'|mol=Genomic|build=128 GTCCTGCGCG CCTGCATGGA GAAGGGTGTT AAGGTGGTGG CTGTGAATGA TCCATTCATT R ACCCGGAATA CATGGTCAGT AGCTGGCAGA GGGCAGGAAC AGCAGGGTGG GACTGGGGTG   GeneView GeneView via analysis of contig annotation: GAPDHS glyceraldehyde-3-phosphate dehydrogenase, spermatogenic View variations for gene: Include clinically associated: in gene region cSNP has frequency double hit Group Label Contig->mRNA Gene Model (contig mRNA transcript) Color Legend reference NT_011109->NM_014364 sv function HuRef NW_001838494->NM_014364 sv function Celera NW_927206->NM_014364 sv function " Group label Contig-->mRNA-->Protein Contig position mRNA orientation mRNA pos Function dbSNP allele Protein residue Codon pos Amino acid pos reference NT_011109->NM_014364->NP_055179 8297509 forward 444 missense A Asn [N] 1 110 contig reference G Asp [D] 1 110 HuRef NW_001838494->NM_014364->NP_055179 1146793 forward 444 missense A Asn [N] 1 110 contig reference G Asp [D] 1 110 Celera NW_927206->NM_014364->NP_055179 8314312 forward 444 missense A Asn [N] 1 110 contig reference G Asp [D] 1 110 GeneView: no link established by BLAST analysis of mRNA sequences   Integrated Maps: NCBI MapViewer:  rs2285514 maps exactly once on NCBI human chromosome 19 Chromosome Contig accession Contig position Chromosome position Hit orientation Contig Allele Assembly Type Group label Contig label Neighbor SNP SNP_flank position 19 NW_001838494.1 1146793 32534736 plus G alt_assembly_8 HuRef HuRef view 60 19 NW_927206.1 8314312 32742744 plus G alt_assembly_1 Celera Celera view 60 19 NT_011109.15 8297509 40721131 plus G ref_assembly reference reference view 60   NCBI Resource Links Submitter-Referenced GenBank AC002389.1 dbSNP Blast Analysis GenBank HTGS Finished: AC002389.1 NC_000019.8 UniGene Cluster ID 248017   Population Diversity Sample Ascertainment Genotype Detail Alleles ss# Population Individual Group Chrom. Sample Cnt. Source A/G G/G HWP A G ss3225656 HapMap-CEU European 114 IG 1.000 1.000 HapMap-HCB Asian 88 IG 1.000 1.000 HapMap-JPT Asian 86 IG 0.047 0.953 0.023 0.977 HapMap-YRI Sub-Saharan African 116 IG 1.000 1.000 Summary Average Het.+/- std err: Individual Count Founders Count Individual Overlap Genotype Conflict 0.010+/-0.069 270 210 0 0   Validation Summary: Validation status Marker displays Mendelian segregation PCR results confirmed in multiple reactions Homozygotes detected in individual genotype data UNKNOWN UNKNOWN UNKNOWN

GENERAL: Contact Us | Homepage | Announcements |dbSNP Summary | Genome | FTP SERVER | Build History | Handle Request
DOCUMENTATION: FAQ | Searchable FAQ Archive | Overview | How to Submit | RefSNP Summary Info | Database Schema
SEARCH: Entrez SNP | Blast SNP | Batch Query | By Submitter |New Batches | Method | Population | Publication | Batch | Locus Info | Between Marker
HAPLOTYPE:Submission | Specifications | Sample HapSet | Sample Individual
NCBI: PubMed | Entrez | BLAST | OMIM | Taxonomy | Structure

Disclaimer     Privacy statement

Revised: May 25, 2006 1:38 PM .