Reference SNP(refSNP) Cluster Report: rs3122257

Reference SNP(refSNP) Cluster Report: rs3122257

refSNP ID: rs3122257
Organism:	human (Homo sapiens)
Molecule Type:	Genomic
Created/Updated in build:	103/129
Map to Genome Build:	36.3

Allele
Variation Class:	SNP: single nucleotide polymorphism
RefSNP Alleles:	C/T
Ancestral Allele:	Not available
Clinical Association:	unknown

HGVS Names

Links

SNP Details are organized in the following sections:

Submitter records for this RefSNP Cluster

The submission ss4367756 has the longest flanking sequence of all cluster members and was used to instantiate sequence for rs3122257 during BLAST analysis for the current build.

NCBI Assay ID	Handle\|Submitter ID	Validation Status	ss to rs Orientation /Strand	Alleles	5' Near Seq 30 bp	3' Near Seq 30 bp	Entry Date	Update Date	Build Added	Molecule Type	Freq Warning	Ancestral Allele	Success Rate
ss4367756	SC_JCM\|AL450342.15_116682		fwd/B	C/T	ttagatgcaggttccttaccagatatatga	ttgcaaatattttctcccattttgtgtttt	02/19/02	10/10/03	103	Genomic			unknown

Fasta sequence (Legend)

 TGTAGCAATT TACTATGCTG CCAGTAGTGG ATAAGAATAT CACTTTCATA GTACCATCAG
 CAGAgagagt cttttcattt gtctattggc catttctata tcttctttgg aaaaatacct
 attcaaattt tttgtcttta ttattgaatt ttaggcattc tttgtatatt ttagatgcag
 gttccttacc agatatatga
 Y
 ttgcaaatat tttctcccat tttgtgtttt tttttttttc tttttcttga tgttacactt
 tgaagctcaa gaatttttaa ttttgacaaa gtcagtttat tatttttttt cttttcttct
 gttttcggga tcatatttaa gaagctaatc taagttcatg aagatttATG TTTCTTCTAA
 GAATTTTATA GCTTTAGCTC

GeneView

GeneView: no link established by analysis of contig annotation
GeneView: no link established by BLAST analysis of mRNA sequences

Integrated Maps:

NCBI MapViewer: See all two hits of rs3122257 on the NCBI human genome map
!WARNING: Several map positions found! The map position is found by blasting with the contig sequences.

Chromosome	Contig accession	Contig position	Chromosome position	Hit orientation	Contig Allele	Assembly Type	Group label	Contig label	Neighbor SNP	SNP_flank position
10	NT_035036.2	157651	51015067	minus	A	ref_assembly	reference	reference	view	200
10	NT_008583.16	200837	51319688	plus	T	ref_assembly	reference	reference	view	200
Un	NW_001841023.1	1743	unplaced	plus	T	alt_assembly_8	HuRef	HuRef	view	200
Un	NW_927934.1	14937	unplaced	minus	G	alt_assembly_1	Celera	Celera	view	200

NCBI Resource Links

Submitter-Referenced
GenBank
AL450342 AC037457

dbSNP Blast Analysis
GenBank HTGS Finished:	GenBank HTGS Draft:
AL450342.16 AL672187.12 NC_000010.9	AC141459.1 AC142442.1 AC142542.1 AC142548.1 AC143350.1 AC143351.1 AC144355.1

Population Diversity

There is no frequency data.

Validation Summary:

Validation status	Marker displays Mendelian segregation	PCR results confirmed in multiple reactions	Homozygotes detected in individual genotype data
	UNKNOWN	UNKNOWN	UNKNOWN

Disclaimer Privacy statement

Revised: May 25, 2006 1:38 PM .