 |  |
| ||||
Copyright © 2006 Cheng-Ping Hu et al. LIF Upregulates Expression of NK-1R in NHBE Cells *Cheng-Ping Hu: Email: huchengp28/at/hotmail.com Received March 24, 2006; Revised July 30, 2006; Accepted August 7, 2006. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. | |||||||||||
Abstract Leukemia inhibitory factor (LIF), a cytokine at the interface
between neurobiology and immunology, is mainly mediated through
JAK/STAT pathway and MAPK/ERK pathway. Evidence suggested LIF is
related to the higher expression of neurokinin-1 receptor (NK-1R)
in asthma. In this study, the immunohistochemistry stain showed
the expressions of NK-1R, LIF, p-STAT3, and p-ERK1/2 in the lung
tissues of allergic rats were increased compared with the
controls, and the main positive cell type was airway epithelial
cell. Normal human bronchial epithelial cells were treated with
LIF in the presence or absence of AG490 (JAK2 inhibitor),
PD98059 (MEK inhibitor), and the siRNA against STAT3. Western blot
and RT-PCR indicated that LIF induced the expression of NK-1R,
which was inhibited by the inhibitors mentioned above. No
significant interaction was found between JAK/STAT pathway and
MAPK/ERK pathway. In summary, bronchial epithelial cell changes in
asthma are induced by LIF which promotes the expression of NK-1R,
and JAK/STAT pathway and MAPK/ERK pathway may participate in
this process. | |||||||||||
INTRODUCTION Leukemia inhibitory factor (LIF) is a pleiotrophic glycoprotein that belongs to the interleukin-6 (IL-6) cytokine family, which shares gp130 as the signal transducer. In the downstream of gp130, two important signal-transducing pathways have been recognized, the janus kinase/signal transducer and activator of transcription (JAK/STAT) pathway and the ras mitogen-activated protein kinase (MAPK) pathway [1–6]. There is widespread distribution of LIF within human lung tissue, where its physiological level is very low, but when exposed to proinflammatory cytokines such as IL-1β, LIF gene expression upregulated [7]. In addition, high levels of LIF were also found in atopic patients and patients with diffuse pulmonary inflammation [8, 9]. Similar to the other neurotrophic factors such as nerve growth factor (NGF), it has been reported that LIF has been implicated in various processes of neuronal development, differentiation, survival and neurogenesis [10–12]. Furthermore, it was indicated that LIF could increase the expression of substance P and its receptor (neurokinin-1 receptor; NK-1R) both in mRNA and protein levels [13, 14]. Substance P and its receptor are main effective substances in airway neurogenic inflammation, Hu et al demonstrated that NGF upregulates NK-1R expression in normal rat lungs, and the expression of NK-1R increased in rat lungs which were infected with respiratory syncytial virus [15–17]. These data suggested that LIF has neuromodulatory role in the airways and may be an important signal molecule in the airway response to inflammation [18]. Bronchial epithelial cell is a barrier to airway structure, and it is an important target cell type in most respiratory diseases such as asthma. High levels of LIF and NK-1R were observed in bronchial epithelial cells of asthmatic rats [19]. However, whether the increased expression of NK-1R is related to LIF is unknown. If so, whether the role of LIF is mediated through JAK/STAT pathway and (or) MAPK pathway needs further investigation. | |||||||||||
MATERIALS AND METHODS Animal preparation of asthmatic models Healthy male Sprague-Dawley rats, 6 to 8 weeks of age, were
provided by the experimental animal center of Central South
University. The animals were divided into 2 groups at random
(asthmatic group and control group, n = 10), and they were housed
under specific pathogen-free conditions. Sensitization (the
asthmatic group) was produced with an intraperitoneal injection of
100 mg of chicken OVA(Sigma), 200 mg of aluminum
hydroxide(Sigma), and 5 × 109 heat-killed
Bordetella pertussis (Wuhan Institute of Biological
Products) in 1 ml of sterile saline. The sham sensitization
group (the control group) was treated by sterile saline
intraperitoneal injection. Two weeks later, the rats in the
asthmatic group were placed in a Plexiglas chamber (20 L) and
challenged every day with 1% OVA for 30 min using an
ultrasonic nebulizer, while those in the control group received
filtered air only. After a challenge peroid (10 days), the rats
were killed by decapitation and bloodletting, and nonperfused
excised lung tissues were fixed in 4% polyoxymethylene, then
embedded in paraffin, and finally sliced into sections
(5 μm thick) for further study. The study protocol was in
accordance with the guidelines for animal research and was
approved by the Ethical and Research Committee of the hospital.Cell culture Normal human bronchial epithelial (NHBE) cells were obtained from
the cell culture collection center of Yuantai Biosource (it was
conducted in accordance with the declaration of Helsinki and the
guidelines of the Ethical and Research Committee of the hospital).
NHBE cells were cultured in Dulbecco's modified Eagle's medium
supplemented with 10% fetal bovine serum, and cells were
maintained at 37° in a humidified atmosphere containing
5% CO2. After 24 h in serum-free medium, cells were stimulated with recombinant human LIF(Chemicon) (5 ng/ml,
30 min for detecting STAT3 and ERK1/2; 5 ng/ml, 24 h
for detecting NK-1R) in pre-exposure or absence of AG-490 (JAK2
inhibitor, Biosource) (50 nmol/mL, 1 h), PD-98059 (MEK
inhibitor, Cell signaling technology) (20 nmol/mL, 1 h),
PMA(ALEXIS Biochemicals) (10 ng/mL, 4 h), and the small
interfering RNA(siRNA) against STAT3(Genesil
Biotechnology) (2 μg/mL, 24 h).Immunohistochemistry and immunocytochemistry Immunoreactivity for phospho-STAT3(p-STAT3),
phospho-ERK1/2(p-ERK1/2), NK-1R and LIF proteins were detected by
streptavidin-biotin peroxidase complex method(SABC) (Boster
Biotechnology). The primary antibodies against rat p-STAT3(rabbit
polyclonal antibody, Santa Cruz Biotechnology), p-ERK1/2(mouse
polyclonal antibody, Santa Cruz Biotechnology), NK-1R(rabbit
polyclonal antibody, Novus Biologicals), and LIF(rabbit polyclonal
antibody, Boster Biotechnology) were applied respectively. The
secondary antibodies were affinity-purified biotinylated goat
anti-rabbit(mouse) IgG (Boster Biotechnology). Nuclei were
counterstained lightly with hematoxylin.NHBE cells were plated at an approximate density of 2×105 cells/cm2 onto tissue culture chamber slides (Lab Tek, Tokyo) in medium containing 10% FBS. After 24 h, cells were replenished with serum-free medium and incubated for 24 h. NHBE cells were preincubated with or without AG-490, PD-98059, PMA, or the siRNA against STAT3 and then stimulated with LIF. Following this, the cells were fixed in 4% polyoxymethylene, and stained with primary antibody against NK-1R. Primary antibody was detected by affinity-purified biotinylated secondary antibody (Boster Biotechnology), and the stained cells were observed by microscopy. Ten fields (×200) were chosen at random under microscope, and a positive cell ratio was obtained by counting (positive cells number/total cells number). RNA interference The siRNA oligonucleotide sequences against STAT3 (NM_139276.2)
were in accordance with Lee et al and Konnikova
et al [20, 21], siRNA-1: 5′-GATCCGCATCTGCCTAGATCGGCTATTCAAGACGTAGCCGATCTAGGCAGATGTTTTTTGAATTCA-3′,
3′-GCGTAGACGGATCTAGCCGATAAGTTCTGCATCGGCTAGATCCGTCTACAAAAAACTTAAGTTCGA-5′;
siRNA-2:
5′-GATCCGTGTTCTCTATCAGCACAATTTCAAGACGATTGTGCTGATAGAGAACATTTTTTGAATTCA-3′,
3′-GCACAAGAGATAGTCGTGTTAAAGTTCTGCTAACACGACTATCTCTTGTAAAAAACTTAAGTTCGA-5;
negative control siRNA:
5′-GATCCGACTTCATAAGGCGCATGCTTCAAGACGGCATGCGCCTTATGAAGTCTTTTTTGTCGACA-3′,
3′-GCTGAAGTATTCCGCGTACGAAGTTCTGCCGTACGCGGAATACTTCAGAAAAAACAGCTGTTCGA-5′
(synthesized by Genesil Biotechnology). The siRNAs
(2 μg/mL) were introduced into cells using the METAFECTENE
highly efficient transfection reagent (Biontex) according to the
manufacturer's instructions.Western blot Cells were harvested in lysis buffer, and the lysates were cleared
by centrifugation at 12000 g for 10 min at 4°. The
proteins were separated by 10% SDS-PAGE, and transferred to
polyvinylidene difluoride membranes, then probed with primary
antibodies against human STAT3, p-STAT3(tyr) (rabbit polyclonal
antibody, Santa Cruz Biotechnology), ERK1/2, p-ERK1/2 (mouse
polyclonal antibody, Santa Cruz Biotechnology), GAPDH (rabbit
polyclonal antibody, Santa Cruz Biotechnology). The primary
antibodies that bounded to the target proteins were detected using
horseradish peroxidase-conjugated anti-rabbit IgG(Promega), or
anti-mouse IgG(Cortex Biochem), as appropriate. The antibodies
were visualized with enhanced chemiluminescent detection (Pierce
Biotechnology). The intensity of target bands was corrected by
GAPDH calculated with the FluorChem 8900 software system.RT-PCR Total RNAs were extracted using TRIZOL(Invitrogen). cDNAs were
synthesized using the RevertAid H Minus First Strand cDNA
Synthesis Kit (Fermentas) with oligo(dT)18 primers. The primer
sequences used were as follows. Human NK-1R: forward primer 5′
GGGACTCCTCTGACCGCTAC 3′, reverse primer 5′
TCCAGGCGGCTGACTTTGTA 3′, PCR product 376 bp (753–1128);
human β-actin: forward primer 5′ CCTTCCTGGGCATGGAGTC 3′,
reverse primer 5′ GAGGAGCAATGATCTTGATCTTC 3′, PCR
product 204 bp (867–1070). RT-PCR analysis was
performed as described by Hu et al with minor modifications
[15]. The intensity of target mRNA levels was corrected by β-actin transcripts calculated with the FluorChem 8900
software system.Statistical analysis The data presented in (Figures 1, 2, 3, 4, and 5) were expressed as means ±SD (n = 3). Statistical significance among mean values
was evaluated with an ANOVA. Differences were considered
significant when P < .05.
| |||||||||||
RESULTS Expression of LIF, NK-1R, p-STAT3, and p-ERK1/2
in lung tissues of asthmatic rats Immunohistochemistry was performed in lung tissues of rats, and it
indicated a higher expression of LIF in the asthmatic rats
compared to that in the control group. Consistent with that,
similar changes were observed for NK-1R, p-STAT3, and p-ERK1/2.
The main positive cell type was airway epithelial cell, and other
positive types were also observed such as lymphocyte
(Figure 1).Effects of AG-490, PD-98059, or PMA on LIF-induced
activation of signal transduction and activation of
transcription (STAT3) and ERK1/2 Western blot was performed on cells that had been preincubated
with or without AG-490, PD-98059, or PMA and then stimulated with
LIF. LIF induced activation of tyrosine phosphorylation of STAT3
(versus the control cells, P < .01), and tyrosine phosphorylation
of STAT3 was inhibited by AG-490 (the cells stimulated with LIF in
the presence of AG-490 versus the cells stimulated with LIF,
P < .01), but not by PD-98059 (the cells stimulated with LIF in
the presence of PD-98059 versus the cells stimulated with LIF,
P > .05), and the results also indicated phosphorylation of STAT3
that was not affected by PMA (Figure 2(a)).
Nevertheless, the expression of total-STAT3 was not affected by
the factors mentioned above (Figure 2(b)). LIF induced
activation of phosphorylation of ERK1/2 (versus the control cells,
P < .01), and ERK1/2 activation was inhibited by PD-98059 (the
cells stimulated with LIF in the presence of PD-98059 versus the
cells stimulated with LIF, P < .01), but not by AG-490 (the cells
stimulated with LIF in the presence of AG-490 versus the cells
stimulated with LIF, P > .05) (Figure 2(c)). Similar to
that of total-STAT3, the expression of total-ERK1/2 did not change
(Figures 2(d), 2(e)). PMA increased the expression
of p-ERK1/2 in NHBE cells (versus the control cells, P < .01), but
there was no significant difference between the cells stimulated
with LIF and the cells stimulated with LIF in the presence of PMA.Effects of AG-490, PD-98059, or PMA on LIF-induced
expression of NK-1R Immunocytochemistry and RT-PCR were performed on cells that had
been preincubated with or without AG-490, PD-98059, or PMA and
then stimulated with LIF. LIF induced expression of NK-1R in NHBE
cells (versus the control cells, P < .01), both AG-490 and
PD-98059 suppressed the LIF-induced expression of NK-1R by 58%
(the cells stimulated with LIF in the presence of AG-490 versus
the cells stimulated with LIF, P < .01) and 60% (the cells
stimulated with LIF in the presence of PD-98059 versus the cells
stimulated with LIF, P < .01); on the contrary, PMA increased the
expression of NK-1R in NHBE cells (Figures 3 and
4(a)).Effects of siRNA(STAT3) on LIF-induced activation of
signal transduction and activation of transcription (STAT3)
and ERK1/2 Western blot was performed on cells that had been preincubated
with or without siRNA(STAT3) and then stimulated with LIF.
LIF-induced tyrosine phosphorylation of STAT3 was inhibited by
siRNA-1 and siRNA-2, and the inhibition ratio was 85% and 42%,
respectively (Figure 5(a)). In addition, the expression
of total-STAT3 was also inhibited by siRNA-1 and siRNA-2 (56% and
37%, resp) (Figure 5(b)). Because of the higher
inhibition ratio, siRNA-1 was later chosen for interference in the
cells. However, siRNA-1 did not affect the expression of p-ERK1/2
and total-ERK1/2 (Figures 5(c), 5(d)).Effects of siRNA(STAT3) on LIF-induced expression
of NK-1R Immunocytochemistry and RT-PCR were performed on cells that had
been preincubated with or without siRNA-1 (STAT3) and then
stimulated with LIF. The LIF-induced expression of NK-1R was
inhibited by siRNA-1 both at the mRNA level and the protein level
(the cells stimulated with LIF in the presence of siRNA-1 versus the
cells stimulated with LIF, P < .01), but it was not affected by
negative control siRNA and sham plasmid (the cells stimulated with
LIF in the presence of control siRNA or sham plasmid versus the cells
stimulated with LIF, P > .05) (Figures 3 and 4(b)). | |||||||||||
DISCUSSION LIF is a cytokine at the interface between neurobiology and immunology [22]. Exposure of neural tissue to proinflammatory cytokines, such as IL-1β or injury, increases the synthesis and release of LIF, which in turn increases mRNA and protein of substance P and its receptor (NK-1R). Similarly, LIF also can induce neuropeptide synthesis and release in neurons that do not normally produce neuropeptides, and these studies suggested that LIF has an important neuro-immune linkage function [13, 14, 23]. LIF dose dependently augmented eosinophil migration and other functions in response to substance P, resulting in bidirectional interactions between inflammatory cells and nerves in allergic diseases [8]. It was found that serum LIF levels were higher in atopic patients with mild asthma than in nonatopic normal donors [8]. Consistent with that, high levels of LIF were also found in bronchoalveolar lavage fluid obtained from patients with the acute respiratory distress syndrome, in which there was diffuse pulmonary inflammation [9]. Immunohistochemistry demonstrated the presence of LIF in epithelial cells, mesenchymal cells, and nerve fibers in the human airway, and it was found that these airway structural cell types release LIF and its receptor (LIFR) in response to inflammatory stimuli such as proinflammatory cytokines. Subsequently, LIF augmented contractile responses to tachykinins in airway explants [7, 24]. In animal models, it was indicated that NK-1R was involved in the development of allergen-induced airway hyperreactivity to histamine after both the early asthmatic reactions and late asthmatic reactions, and NK-1R-mediated inflammation of airways may contribute to this process [25]. In the present study, the airway tissues of asthmatic rats were tested by immunohistochemistry, and it was found that LIF expression in the asthmatic rats was higher than that in the normal control group, at the same time, NK-1R expression in the asthmatic rats also increased. Incubation of rat sympathetic cervical ganglia with LIF downregulated the expression of muscarinic M2R mRNA, while at the same time increased the expression of substance P and NK-1R [13, 14]. After incubation of tracheal explants with LIF, there were no observable increases of substance P expression compared to the control, however, measurement of NK-1R expression was not done [18]. Substance P is a member of tachykinin family, which is usually not steadily expressed, and is not easily detected. As a ligand, substance P can express biological effect on the condition of combining with its specific receptor NK-1R, and thus, the biological activity of substance P would be reflected by detecting the expression of NK-1R. LIF is a pleiotrophic glycoprotein that belongs to the IL-6 cytokine family, which shares the common gp130 receptor chain as the signal transducing protein. LIF signaling is mediated through the LIF receptor which heterodimerizes with the gp130 receptor upon LIF binding [5]. Activation of the LIFR-β-gp130 heterodimer results in the rapid activation of janus kinases (JAKs) which in turn phosphorylate tyrosine residues of LIFR-β and gp130 [3, 4, 6]. These phosphorylated tyrosine residues form docking sites for signaling molecules including STAT3 and SHP2 [4]. STATs are transcription factors, which form dimers upon phosphorylation of a specific tyrosine residue that is located in a conserved SHP2 domain [26]. STAT dimerization allows nuclear translocation and the transcriptional activation of target genes [26]. SHP2 is a tyrosine phosphatase which signals upstream of the Ras/MAP kinase signal transduction pathway [4, 27–29]. As a result, downstream of the pathway molecules such as ERK1/2 and p38 is activated sequentially. As the important pathways in eukaryocyte, Ras/MEK/ERK cascade pathway and JAK/STAT cascade pathway may be closely interrelated. In many cell types in culture, sustained expression of activated Ras or its downstream effector can elicit cell cycle arrest and differentiation, and some reseachers revealed that the biological effects of the Ras/Raf/MEK/ERK pathway were activated via LIF/JAK/STAT pathway [30–32]. However, in LIF/gp130-mediated cardiac hypertrophy, AG490 (JAK2 inhibitor) and PD98059 (a specific MEK inhibitor) were applied to compare the significance between ERK cascade and JAK/STAT cascade, and it was shown that LIF-induced expression of c-fos and others was markedly suppressed by PD98059 and moderately suppressed by AG490, but STAT3 activation was not suppressed by PD98059 and ERK1/2 activation was not suppressed by AG490 [33]. It was suggested that the two pathways are independent of each other. In the present study, the airway tissues of asthmatic rats were tested for LIF-linked substance by immunohistochemistry. Compared with the control, there were increased expressions for LIF and NK-1R in the asthmatic rats, and similar changes were observed for p-STAT3 and p-ERK1/2. The main positive cell type was airway epithelial cell, and other types were also observed such as lymphocyte and structural cells. These results were similar to the data provided by Knight et al [24] and Bai et al [34]. Combining these findings with the data mentioned above, it is hypothesized that LIF enhances the NK-1R expression in airway of asthmatic models, and the enhancement may be connected with the JAK-STAT pathway or the MAPK pathway. Furthermore, airway epithelial cells may be the main effective cell type in this process. To test the hypothesis, we cultured NHBE cells treated with LIF, inhibitors of the JAK/STAT and MAPK/ERK pathways (AG490 and PD98059), and the activator of protein kinase C(PMA). This study demonstrated that LIF induced expression of NK-1R in NHBE cells, which was determined by RT-PCR and immunocytochemistry. In this process, similar to NK-1R, the expressions of p-STAT3 and p-ERK1/2 in NHBE cells treated with LIF all increased. Expressions of total-STAT3 and total-ERK1/2 between LIF-treated cells and the control cells were not significantly different. AG490 and PD98059 suppressed the LIF-induced expression of NK-1R. AG490 inhibited the LIF-induced phosphorylation of STAT3, whereas PD98059 showed no inhibition; on the contrary, PD98059 clearly inhibited the LIF-induced phosphorylation of ERK1/2, whereas AG490 showed no inhibition. PMA, a potent activator of protein kinase C, is considered to have a strong effect to activate ERK1/2, and further increase the levels of related substances in the downsteam of ERK pathway (eg, c-fos and c-jun) [35]. Our study showed that, compared with the control, PMA increased the expressions of p-ERK1/2 and NK-1R in NHBE cells; but there was no significant difference between the cells stimulated with LIF in the presence of PMA and the cells stimulated with LIF. These findings indicated that the JAK/STAT pathway and the MAPK pathway play different roles in LIF-induced expression of NK-1R in NHBE cells, and suggest that these pathways may be independent in producing a marked biological effect. To further confirm the results mentioned above, we designed this study to block STAT3 expression by siRNA. It was found that the siRNA against STAT3 specifically reduced STAT3 expression in LIF-induced NHBE cells. For the blockade of STAT3, the LIF-induced expression of NK-1R also decreased, whereas the expression of ERK1/2 (p-ERK1/2 and total-ERK1/2) did not change in this process. In conclusion, we have demonstrated that NK-1R expression is upregulated in NHBE cells when exposed to LIF, and this process may be mediated by JAK2/STAT3 pathway and ERK1/2 pathway, but no observable interaction was found between the two pathways in the present study. Since signaling cascades often converge from multiple upstream mediators, it is possible that the cross-talk and alternative pathways exist. Thus, whether these factors influenced our results further investigation is required. | |||||||||||
ACKNOWLEDGMENT This work was supported by National Natural Scientific Foundation of China (no. 30300146). | |||||||||||
References 1. Jo, C; Kim, H; Jo, I, et al. Leukemia inhibitory factor blocks early differentiation of
skeletal muscle cells by activating ERK. Biochimica et Biophysica Acta - Molecular Cell
Research. 2005;1743(3):187–197. 2. Schiemann, WP; Bartoe, JL; Nathanson, NM. Box 3-independent signaling mechanisms are involved in
leukemia inhibitory factor receptor α- and
gp130-mediated stimulation of mitogen-activated protein
kinase. Evidence for participation of multiple signaling
pathways which converge at Ras. Journal of Biological Chemistry. 1997;272(26):16631–16636. [PubMed] 3. Schuringa, JJ; van der Schaaf, S; Vellenga, E. LIF-induced STAT3 signaling in murine versus human
embryonal carcinoma (EC) cells. Experimental Cell Research. 2002;274(1):119–129. [PubMed] 4. Heinrich, PC; Behrmann, I; Muller-Newen, G; Schaper, F; Graeve, L. Interleukin-6-type cytokine signalling through the
gp130/Jak/STAT pathway. Biochemical Journal. 1998;334(2):297–314. [PubMed] 5. Gearing, DP; Comeau, MR; Friend, DJ, et al. The IL-6 signal transducer, gp130: an oncostatin M receptor
and affinity converter for the LIF receptor. Science. 1992;255(5050):1434–1437. [PubMed] 6. Stahl, N; Boulton, TG; Farruggella, T, et al. Association and activation of Jak-Tyk kinases by
CNTF-LIF-OSM-IL-6 β receptor components. Science. 1994;263(5143):92–95. [PubMed] 7. Knight, DA; Lydell, CP; Zhou, D; Weir, TD; Schellenberg, RR; Bai, TR. Leukemia inhibitory factor (LIF) and LIF receptor in human
lung distribution and regulation of LIF release. American Journal of Respiratory Cell and Molecular
Biology. 1999;20(4):834–841. [PubMed] 8. Zheng, X; Knight, DA; Zhou, D, et al. Leukemia inhibitory factor is synthesized and released
by human eosinophils and modulates activation state and
chemotaxis. Journal of Allergy and Clinical Immunology. 1999;104(1):136–144. [PubMed] 9. Jorens, PG; De Jongh, R; Bossaert, LL, et al. High levels of leukaemia inhibitory factor in ARDS. Cytokine. 1996;8(11):873–876. [PubMed] 10. Kim, EJ; Simpson, PJ; Park, D-J; Liu, BQ; Ronnett, GV; Moon, C. Leukemia inhibitory factor is a proliferative factor for
olfactory sensory neurons. NeuroReport. 2005;16(1):25–28. [PubMed] 11. Yamamori, T; Fukada, K; Aebersold, R; Korsching, S; Fann, M-J; Patterson, PH. The cholinergic neuronal differentiation factor from heart
cells is identical to leukemia inhibitory factor. Science. 1989;246(4936):1412–1416. [PubMed] 12. Murphy, M; Reid, K; Brown, MA; Bartlett, PF. Involvement of leukemia inhibitory factor and nerve
growth factor in the development of dorsal root ganglion
neurons. Development. 1993;117(3):1173–1182. [PubMed] 13. Ludlam, WH; Chandross, KJ; Kessler, JA. LIF-and IL-1β-mediated increases in substance
P receptor mRNA in axotomized, explanted or dissociated
sympathetic ganglia. Brain Research. 1995;685(1-2):12–20. [PubMed] 14. Ludlam, WH; Zang, Z; McCarson, KE; Krause, JE; Spray, DC; Kessler, JA. mRNAs encoding muscarinic and substance P receptors in
cultured sympathetic neurons are differentially regulated
by LIF or CNTF. Developmental Biology. 1994;164(2):528–539. [PubMed] 15. Hu, C-P; Wedde-Beer, K; Auais, A; Rodriguez, MM; Piedimonte, G. Nerve growth factor and nerve growth factor receptors in
respiratory syncytial virus-infected lungs. American Journal of Physiology - Lung Cellular
and Molecular Physiology. 2002;283(2):L494–L502. [PubMed] 16. King, KA; Hu, C-P; Rodriguez, MM; Romaguera, R; Jiang, X; Piedimonte, G. Exaggerated neurogenic inflammation and substance P receptor
upregulation in RSV-infected weanling rats. American Journal of Respiratory Cell and Molecular
Biology. 2001;24(2):101–107. [PubMed] 17. Piedimonte, G. Contribution of neuroimmune mechanisms to airway
inflammation and remodeling during and after respiratory
syncytial virus infection. Pediatric Infectious Disease Journal. 2003;22(suppl 2):S66–S75. [PubMed] 18. Knight, DA; D'Aprile, AC; Spalding, LJ; Goldie, RG; Thompson, PJ. Leukaemia inhibitory factor (LIF) upregulates excitatory
non-adrenergic non-cholinergic and maintains cholinergic
neural function in tracheal explants. British Journal of Pharmacology. 2000;130(5):975–979. [PubMed] 19. Lin, M-J; Lao, XJ; Ma, HM; Tang, Y-L. The relationship between leukemia inhibitory factor
and neurokinin receptors in a rat model of asthma
[in Chinese]. Zhonghua Jie He He Hu Xi Za Zhi. 2005;28(12):820–824. [PubMed] 20. Lee, SO; Lou, W; Qureshi, KM; Mehraein-Ghomi, F; Trump, DL; Gao, AC. RNA interference targeting STAT3 inhibits growth and induces
apoptosis of human prostate cancer cells. The Prostate. 2004;60(4):303–309. [PubMed] 21. Konnikova, L; Kotecki, M; Kruger, MM; Cochran, BH. Knockdown of STAT3 expression by RNAi induces apoptosis
in astrocytoma cells. BMC Cancer. 2003;3(1):23–31. [PubMed] 22. Patterson, PH. Leukemia inhibitory factor, a cytokine at the interface
between neurobiology and immunology. Proceedings of the National Academy of Sciences of
the United States of America. 1994;91(17):7833–7835. [PubMed] 23. Kessler, JA; Freidin, MM; Kalberg, C; Chandross, KJ. Cytokines regulate substance P expression in sympathetic
neurons. Regulatory Peptides. 1993;46(1-2):70–75. [PubMed] 24. Knight, DA; McKay, K; Wiggs, B; Schellenberg, RR; Bai, TR. Localization of leukaemia inhibitory factor to airway
epithelium and its amplification of contractile responses
to tachykinins. British Journal of Pharmacology. 1997;120(5):883–891. [PubMed] 25. Schuiling, M; Zuidhof, AB; Zaagsma, J; Meurs, H. Involvement of tachykinin NK1 receptor in the development
of allergen-induced airway hyperreactivity and airway
inflammation in conscious, unrestrained guinea pigs. American Journal of Respiratory and Critical Care
Medicine. 1999;159(2):423–430. [PubMed] 26. Schindler, C; Darnell, JE., Jr Transcriptional responses to polypeptide ligands:
the JAK-STAT pathway. Annual Review of Biochemistry. 1995;64:621–651. 27. Fukada, T; Hibi, M; Yamanaka, Y, et al. Two signals are necessary for cell proliferation
induced by a cytokine receptor gp130: involvement
of STAT3 in anti-apoptosis. Immunity. 1996;5(5):449–460. [PubMed] 28. Nishida, K; Yoshida, Y; Itoh, M, et al. Gab-family adapter proteins act downstream of cytokine
and growth factor receptors and T- and B-cell antigen
receptors. Blood. 1999;93(6):1809–1816. [PubMed] 29. Takahashi-Tezuka, M; Yoshida, Y; Fukada, T, et al. Gab1 acts as an adapter molecule linking the cytokine
receptor gp130 to ERK mitogen-activated protein kinase. Molecular and Cellular Biology. 1998;18(7):4109–4117. [PubMed] 30. Park, J-I; Strock, CJ; Ball, DW; Nelkin, BD. The Ras/Raf/MEK/ extracellular
signal-regulated kinase pathway induces autocrine-paracrine
growth inhibition via the leukemia inhibitory
factor/JAK/STAT pathway. Molecular and Cellular Biology. 2003;23(2):543–554. [PubMed] 31. Park, J-I; Strock, CJ; Ball, DW; Nelkin, BD. Interleukin-1β can mediate growth arrest and
differentiation via the leukemia inhibitory factor/JAK/STAT
pathway in medullary thyroid carcinoma cells. Cytokine. 2005;29(3):125–134. [PubMed] 32. Park, J-I; Powers, JF; Tischler, AS; Strock, CJ; Ball, DW; Nelkin, BD. GDNF-induced leukemia inhibitory factor can mediate
differentiation via the MEK/ERK pathway in pheochromocytoma
cells derived from nf1-heterozygous knockout mice. Experimental Cell Research. 2005;303(1):79–88. [PubMed] 33. Kodama, H; Fukuda, K; Pan, J, et al. Significance of ERK cascade compared with JAK/STAT and
PI3-K pathway in gp130-mediated cardiac hypertrophy. American Journal of Physiology - Heart and Circulatory
Physiology. 2000;279(4):H1635–H1644. [PubMed] 34. Bai, TR; Zhou, D; Weir, T, et al. Substance P (NK1)- and neurokinin A (NK2)-receptor gene
expression in inflammatory airway diseases. American Journal of Physiology. 1995;95(269):L309–L317. [PubMed] 35. Deng, X-F; Rokosh, DG; Simpson, PC. Autonomous and growth factor-induced hypertrophy in
cultured neonatal mouse cardiac myocytes: comparison
with rat. Circulation Research. 2000;87(9):781–788. [PubMed] | |||||||||||
