PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure

Search Entrez NCBI Web site ------------- Books CloneRegistry Domains 3D Domains Gene Genome GEO GEO Datasets HomoloGene Journals MapViewer MeSH Nucleotide OMIM PMC PopSet Protein PubMed SNP Structure Taxonomy UniGene UniSTS for

Entrez UniSTS Help Query tips Submit Submit map FTP site Statistics Related sites e-PCR Map Viewer Gene UniGene dbSNP GeneMap'99 MGD ZFIN Genomic biology Bos taurus Canis familiaris Danio rerio Homo sapiens Mus musculus Rattus novegicus Sus scrofa

UniSTS:37873 Links STS-U89896 Homo sapiens chromosome 9;19, loci JAK2 and CSNK1G2 Macaca mulatta chromosome 19;15, loci LOC709484 and JAK2 Pan troglodytes chromosome 19;9, loci JAK2 and CSNK1G2 Found by e-PCR in sequences from Homo sapiens and Pan troglodytes. Primer Information Forward primer: CTGAATCTTCTCCGTGCAGC Reverse primer: GAGGGGAGGACTAGACACAGG PCR product size: 215 (bp), Homo sapiens    Homo sapiens Name: STS-U89896 Also known as: sts-U89896 Polymorphism info:   Cross References Gene GeneID: 1455   Symbol: CSNK1G2   Description: casein kinase 1, gamma 2   Position: 19p13.3 Gene GeneID: 3717   Symbol: JAK2   Description: Janus kinase 2 (a protein tyrosine kinase)   Position: 9p24 UniGene Hs.651905 Casein kinase 1, gamma 2   Hs.656213 Janus kinase 2 (a protein tyrosine kinase) Mapping Information STS-U89896 Sequence Map: Chr 9|Celera Map Viewer   Position: 4967568-4968103 (bp)   STS-U89896 Sequence Map: Chr 9|HuRef Map Viewer   Position: 4997492-4998028 (bp)   STS-U89896 Sequence Map: Chr 9 Map Viewer   Position: 5031944-5032479 (bp)   STS-U89896 Sequence Map: Chr 19|HuRef Map Viewer   Position: 1752488-1752702 (bp)   STS-U89896 Sequence Map: Chr 19|Celera Map Viewer   Position: 1914222-1914436 (bp)   STS-U89896 Sequence Map: Chr 19 Map Viewer   Position: 1931223-1931437 (bp)   sts-U89896 NCBI RH Map: Chr 9 Map Viewer   Position: 14.3 (cR)   Lod score: 1.42   sts-U89896 GeneMap99-GB4 Map: Chr 9 Map Viewer   Position: 26.77 (cR3000)   Lod score: 1.21   Reference Interval: D9S178-D9S168 Electronic PCR results RefSeq mRNA (1) NM_001319.6 1792 .. 2006 (215 bp)     mRNA (5 of 6)[Show All Hits] U89896.1 1508 .. 1722 (215 bp)   AY007134.1 493 .. 707 (215 bp)   BC020972.1 1322 .. 1536 (215 bp)   BC018699.2 1765 .. 1979 (215 bp)   BC018693.2 1765 .. 1979 (215 bp)     Genomic (5 of 14)[Show All Hits] AL161450.14 23235 .. 23770 (536 bp)   AC005306.2 30299 .. 30513 (215 bp)   CH003466.1 1979962 .. 1980176 (215 bp)   CH003456.1 5090838 .. 5091376 (539 bp)   CH003514.1 834267 .. 834481 (215 bp)     ESTs (5 of 57)[Show All Hits] W72092.1 29 .. 240 (212 bp)   AA052932.1 28 .. 237 (210 bp)   AA148169.1 28 .. 236 (209 bp)   AA609691.1 186 .. 397 (212 bp)   AA669193.1 26 .. 239 (214 bp)     Whole Genome Shotgun sequences (5 of 8)[Show All Hits] AADD01161969.1 767 .. 981 (215 bp)   AADD01097348.1 13648 .. 14186 (539 bp)   AADC01136483.1 11979 .. 12193 (215 bp)   AADC01080925.1 4653 .. 5191 (539 bp)   AADB02019952.1 56841 .. 57055 (215 bp)        Macaca mulatta Name: STS-U89896 Polymorphism info:   Cross References Gene GeneID: 694184   Symbol: JAK2   Description: Janus kinase 2   Position:   Gene GeneID: 709484   Symbol: LOC709484   Description: hypothetical protein LOC709484   Position:   UniGene Mmu.10077 Hypothetical protein LOC709484 Mapping Information STS-U89896 Sequence Map: Chr 15 Map Viewer   Position: 72171043-72171258 (bp)   STS-U89896 Sequence Map: Chr 19 Map Viewer   Position: 1760589-1760806 (bp)    Pan troglodytes Name: STS-U89896 Polymorphism info:   Cross References Gene GeneID: 455559   Symbol: CSNK1G2   Description: casein kinase 1, gamma 2   Position:   Gene GeneID: 464979   Symbol: JAK2   Description: Janus kinase 2 (a protein tyrosine kinase)   Position:   Mapping Information STS-U89896 Sequence Map: Chr 9 Map Viewer   Position: 5151958-5152163 (bp)   STS-U89896 Sequence Map: Chr 19 Map Viewer   Position: 1966376-1966590 (bp) Electronic PCR results RefSeq mRNA (1) XM_512246.2 1200 .. 1414 (215 bp)     Genomic (2) CM000333.1 1966376 .. 1966590 (215 bp)   CM000323.1 5151958 .. 5152163 (206 bp)     Whole Genome Shotgun sequences (4) AADA01137893.1 880 .. 1094 (215 bp)   AADA01036386.1 9787 .. 9992 (206 bp)   AACZ02180651.1 811 .. 1025 (215 bp)   AACZ02101891.1 20504 .. 20709 (206 bp)

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement