PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure

Search Entrez NCBI Web site ------------- Books CloneRegistry Domains 3D Domains Gene Genome GEO GEO Datasets HomoloGene Journals MapViewer MeSH Nucleotide OMIM PMC PopSet Protein PubMed SNP Structure Taxonomy UniGene UniSTS for

Entrez UniSTS Help Query tips Submit Submit map FTP site Statistics Related sites e-PCR Map Viewer Gene UniGene dbSNP GeneMap'99 MGD ZFIN Genomic biology Bos taurus Canis familiaris Danio rerio Homo sapiens Mus musculus Rattus novegicus Sus scrofa

UniSTS:64747 Links D2S428 Homo sapiens chromosome 2, polymorphic Macaca mulatta chromosome 13 Pan troglodytes chromosome 2A Found by e-PCR in sequences from Homo sapiens and Pan troglodytes. Primer Information Forward primer: TCACTTAGCAAGTAAGATACAGCC Reverse primer: AAACTAGAATCACAATAACCTCAGA PCR product size: 143-158 (bp), Homo sapiens GenBank Accession: G08132    Homo sapiens Name: D2S428 Also known as: CHLC.1053 CHLC.GATA14B12 CHLC.GATA14B12.1053 CHLC.GATA14B12.P7109 GATA-D2S428 GATA-P7109 GATA14B12 GDB:686511 SHGC-17740 SHGC-4060 Polymorphism info: on genetic map Cross References Mapping Information D2S428 Sequence Map: Chr 2|Celera Map Viewer   Position: 82810064-82810216 (bp)   D2S428 Sequence Map: Chr 2 Map Viewer   Position: 82835278-82835430 (bp)   D2S428 Sequence Map: Chr 2|HuRef Map Viewer   Position: 82875367-82875515 (bp)   D2S428 deCODE Map: Chr 2 Map Viewer   Position: 107.03 (cM)   GATA14B12 Marshfield Map: Chr 2 Map Viewer   Position: 103.16 (cM)   SHGC-4060 NCBI RH Map: Chr 2 Map Viewer   Position: 436.3 (cR)   Lod score: 5.00   SHGC-17740 TNG Map: Chr 2 Map Viewer   Position: 51460 (cR50000)   Lod score: 3.5   Reference Interval: 152   SHGC-4060 Stanford-G3 Map: Chr 2 Map Viewer   Position: 3478 (cR10000)   Lod score: F   Reference Interval: 45   CHLC.GATA14B12.1053 Whitehead-RH Map: Chr 2 Map Viewer   Position: 346.1 (cR3000)   Lod score: P0.01   CHLC.GATA14B12.1053 Whitehead-YAC Map: Chr 2 Map Viewer   Reference Interval: WC2.5 Electronic PCR results Genomic (5 of 8)[Show All Hits] G08132.1 5 .. 161 (157 bp)   AC104799.4 115865 .. 116017 (153 bp)   CH003449.1 82716942 .. 82717094 (153 bp)   CH003497.1 85751536 .. 85751685 (150 bp)   CH471053.2 82741999 .. 82742151 (153 bp)     Working Draft phase 1 (from GenBank HTGS division) (2) AC034300.2 60480 .. 60632 (153 bp)   AC026893.3 7098 .. 7250 (153 bp)     Whole Genome Shotgun sequences (4) AADD01019938.1 15908 .. 16060 (153 bp)   AADC01016822.1 115912 .. 116061 (150 bp)   AADB02001913.1 447427 .. 447579 (153 bp)   ABBA01075698.1 64014 .. 64162 (149 bp)        Macaca mulatta Name: D2S428 Polymorphism info:   Mapping Information D2S428 Sequence Map: Chr 13 Map Viewer   Position: 83273395-83273508 (bp)    Pan troglodytes Name: D2S428 Polymorphism info:   Mapping Information D2S428 Sequence Map: Chr 2A Map Viewer   Position: 84584762-84584903 (bp) Electronic PCR results Genomic (1) CM000315.1 84584762 .. 84584903 (142 bp)     Whole Genome Shotgun sequences (2) AADA01224359.1 3472 .. 3613 (142 bp)   AACZ02022538.1 1388 .. 1529 (142 bp)

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement