PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure

Search Entrez NCBI Web site ------------- Books CloneRegistry Domains 3D Domains Gene Genome GEO GEO Datasets HomoloGene Journals MapViewer MeSH Nucleotide OMIM PMC PopSet Protein PubMed SNP Structure Taxonomy UniGene UniSTS for

Entrez UniSTS Help Query tips Submit Submit map FTP site Statistics Related sites e-PCR Map Viewer Gene UniGene dbSNP GeneMap'99 MGD ZFIN Genomic biology Bos taurus Canis familiaris Danio rerio Homo sapiens Mus musculus Rattus novegicus Sus scrofa

UniSTS:43757 Links D9S165 Homo sapiens chromosome 9 Macaca mulatta chromosome 15 Pan troglodytes chromosome 9 Found by e-PCR in sequences from Homo sapiens and Pan troglodytes. Primer Information Forward primer: GACTTTGGCTGCTAGATGTG Reverse primer: AGAGTTACCCAAGTTTCTGACA PCR product size: 238 (bp), Homo sapiens GenBank Accession: Z16644    Homo sapiens Name: D9S165 Also known as: AFM136xc5 SHGC-757 stSG580 Polymorphism info:   Cross References Mapping Information D9S165 Sequence Map: Chr 9|Celera Map Viewer   Position: 33104452-33104691 (bp)   D9S165 Sequence Map: Chr 9|HuRef Map Viewer   Position: 33131210-33131447 (bp)   D9S165 Sequence Map: Chr 9 Map Viewer   Position: 33163445-33163684 (bp)   SHGC-757 NCBI RH Map: Chr 9 Map Viewer   Position: 420.9 (cR)   Lod score: 2.48   SHGC-757 TNG Map: Chr 9 Map Viewer   Position: 17107 (cR50000)   Lod score: 17.2   Reference Interval: 38   SHGC-757 Stanford-G3 Map: Chr 9 Map Viewer   Position: 1427 (cR10000)   Lod score: F   Reference Interval: 6   AFM136xc5 GeneMap99-G3 Map: Chr 9 Map Viewer   Position: 1474 (cR10000)   Lod score: F   Reference Interval: D9S165-D9S1874 Electronic PCR results Genomic (5 of 7)[Show All Hits] Z16644.1 10 .. 247 (238 bp)   AL161445.10 77093 .. 77332 (240 bp)   CH003504.1 34848400 .. 34848639 (240 bp)   CH471071.2 32988971 .. 32989210 (240 bp)   CM000260.1 33104452 .. 33104691 (240 bp)     Whole Genome Shotgun sequences (3) AADC01082474.1 113717 .. 113956 (240 bp)   AADB02012500.1 312104 .. 312343 (240 bp)   ABBA01065064.1 139790 .. 140027 (238 bp)        Macaca mulatta Name: D9S165 Polymorphism info:   Mapping Information D9S165 Sequence Map: Chr 15 Map Viewer   Position: 44056548-44056788 (bp)    Pan troglodytes Name: D9S165 Polymorphism info:   Mapping Information D9S165 Sequence Map: Chr 9 Map Viewer   Position: 33818893-33819114 (bp)   D9S165 Sequence Map: Chr 9|NW_001240885.1 Map Viewer   Position: 547-774 (bp) Electronic PCR results Genomic (1) CM000323.1 33818893 .. 33819114 (222 bp)     Whole Genome Shotgun sequences (3) AADA01054074.1 16476 .. 16698 (223 bp)   AACZ02109353.1 547 .. 774 (228 bp)   AACZ02103280.1 6244 .. 6465 (222 bp)

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement