PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure

Search Entrez NCBI Web site ------------- Books CloneRegistry Domains 3D Domains Gene Genome GEO GEO Datasets HomoloGene Journals MapViewer MeSH Nucleotide OMIM PMC PopSet Protein PubMed SNP Structure Taxonomy UniGene UniSTS for

Entrez UniSTS Help Query tips Submit Submit map FTP site Statistics Related sites e-PCR Map Viewer Gene UniGene dbSNP GeneMap'99 MGD ZFIN Genomic biology Bos taurus Canis familiaris Danio rerio Homo sapiens Mus musculus Rattus novegicus Sus scrofa

UniSTS:130383 Links D5Mit249 Primer Information Forward primer: AATTCTCCTTTGGCCTCCAT Reverse primer: CTGTCTGTTCAAATATTAGACGCTG PCR product size: 143 (bp), Mus musculus    Mus musculus Name: D5Mit249 Also known as: MT3513 ND Polymorphism info: on genetic map Cross References Gene GeneID: 61058   Symbol: D5Mit249   Description: DNA segment, Chr 5, Massachusetts Institute of Technology 249   Position: 5 1.0 cM MGI MGI:700915   Mapping Information D5Mit249 Sequence Map: Chr 5|Celera Map Viewer   Position: 4516888-4517032 (bp)   D5Mit249 Sequence Map: Chr 5 Map Viewer   Position: 4586369-4586511 (bp)   D5Mit249 MGI Map: Chr 5 Map Viewer   Position: 1.00 (cM)   D5Mit249 WI_GEN Map: Chr 5 Map Viewer   Position: 0.0 (cM)   D5Mit249 WI/MRC-RH Map: Chr 5 Map Viewer   Position: 83.50 (cR)   D5Mit249 WI_YAC Map: Chr 5 Map Viewer   Reference Interval: WC5.1 Electronic PCR results Genomic (3) AC092508.3 122077 .. 122219 (143 bp)   CH466600.1 1516888 .. 1517032 (145 bp)   CM000213.2 1516888 .. 1517032 (145 bp)     Whole Genome Shotgun sequences (2) CAAA01003063.1 16575 .. 16717 (143 bp)   AAHY01042125.1 15983 .. 16127 (145 bp)

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement