PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure

Search Entrez NCBI Web site ------------- Books CloneRegistry Domains 3D Domains Gene Genome GEO GEO Datasets HomoloGene Journals MapViewer MeSH Nucleotide OMIM PMC PopSet Protein PubMed SNP Structure Taxonomy UniGene UniSTS for

Entrez UniSTS Help Query tips Submit Submit map FTP site Statistics Related sites e-PCR Map Viewer Gene UniGene dbSNP GeneMap'99 MGD ZFIN Genomic biology Bos taurus Canis familiaris Danio rerio Homo sapiens Mus musculus Rattus novegicus Sus scrofa

UniSTS:46811 Links DXS8041 Homo sapiens chromosome X, loci CHDS3 and PLAC1, polymorphic Pan troglodytes chromosome X Found by e-PCR in sequences from Homo sapiens and Pan troglodytes. Primer Information Forward primer: GCAAGACTCCGTCTCAAATAATAAC Reverse primer: TTCCTGCTACCTGCAATTCC PCR product size: 144-164 (bp), Homo sapiens GenBank Accession: Z52951    Homo sapiens Name: DXS8041 Also known as: AFMa342zf5 GDB:608871 HSA342ZF5 SHGC-21241 Polymorphism info: on genetic map Cross References Gene GeneID: 10761   Symbol: PLAC1   Description: placenta-specific 1   Position: Xq26 Gene GeneID: 387573   Symbol: CHDS3   Description: Coronary heart disease, susceptibility to, 3   Position: Xq23-q26 Mapping Information DXS8041 Sequence Map: Chr X|HuRef Map Viewer   Position: 123102583-123102739 (bp)   DXS8041 Sequence Map: Chr X Map Viewer   Position: 133531399-133531554 (bp)   DXS8041 Sequence Map: Chr X|Celera Map Viewer   Position: 134090552-134090707 (bp)   AFMa342zf5 Genethon Map: Chr X Map Viewer   Position: 151.70 (cM)   AFMa342zf5 Marshfield Map: Chr X Map Viewer   Position: 82.84 (cM)   SHGC-21241 TNG Map: Chr X Map Viewer   Position: 28566 (cR50000)   Lod score: 4.5   Reference Interval: 105   AFMa342zf5 GeneMap99-G3 Map: Chr X Map Viewer   Position: 4166 (cR10000)   Lod score: F   Reference Interval: DXS1047-DXS998 Electronic PCR results Genomic (5 of 8)[Show All Hits] Z52951.1 101 .. 256 (156 bp)   AC004383.1 154261 .. 154416 (156 bp)   CH003518.1 99104643 .. 99104799 (157 bp)   CH471107.2 14296127 .. 14296282 (156 bp)   CM000274.1 134090552 .. 134090707 (156 bp)     Working Draft phase 1 (from GenBank HTGS division) (1) AL590875.9 208829 .. 208980 (152 bp)     Working Draft phase 2 (from GenBank HTGS division) (1) AC004387.2 99138 .. 99293 (156 bp)     Whole Genome Shotgun sequences (3) AADC01148181.1 244578 .. 244734 (157 bp)   AADB02037286.1 547025 .. 547180 (156 bp)   ABBA01042457.1 3366 .. 3522 (157 bp)        Pan troglodytes Name: DXS8041 Polymorphism info:   Mapping Information DXS8041 Sequence Map: Chr X Map Viewer   Position: 134048166-134048289 (bp) Electronic PCR results Genomic (1) CM000336.1 134048166 .. 134048289 (124 bp)     Whole Genome Shotgun sequences (2) AADA01122841.1 227 .. 350 (124 bp)   AACZ02222150.1 5737 .. 5860 (124 bp)

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement