CDS GC%: 43.5% tRNA GC%: 56.8% rRNA GC%: 52%
IGS# | Up stream Locus | Up stream Product | Down Stream Locus | Down Stream Product | Gene Dir type | Start | End | IGS Len | GC% | IS NT | IS AA | NR | PT-Pair | Intra Spp. IGS | Inter Spp. IGS | Conserved Inter-spp IGS Start | Conserved Inter-spp IGS End | Blast Result | Conserved IGS Seq |
1 | SSA_2382 | Chromosome partitioning protein ParB or transcriptional regulator Spo0J, putative | SSA_0001 | Chromosomal replication initiator protein dnaA, putative | ->-> | 1 | 213 | 213 | 25.8% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
2 | SSA_0001 | Chromosomal replication initiator protein dnaA, putative | SSA_0002 | DNA polymerase III, beta chain, putative | ->-> | 1567 | 1724 | 158 | 26.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
3 | SSA_0002 | DNA polymerase III, beta chain, putative | SSA_2390 | hypothetical protein | ->-> | 2862 | 2988 | 127 | 33.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
4 | SSA_2390 | hypothetical protein | SSA_0004 | Lipoprotein, putative | -><- | 3184 | 3302 | 119 | 30.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
5 | SSA_0004 | Lipoprotein, putative | SSA_0005 | GTP-binding protein, putative | <--> | 3795 | 3960 | 166 | 25.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
12 | SSA_0020 | Ribose-phosphate pyrophosphokinase 1, putative | SSA_0021 | hypothetical protein | ->-> | 26670 | 26981 | 312 | 28.5% | 0 | 0 | 0 | +: 1/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
13 | SSA_0022 | Surface protein cell wall anchor, sortase_B family, putative | SSA_0023 | Aspartate aminotransferase, putative | ->-> | 28489 | 28668 | 180 | 38.9% | 0 | 0 | 0 | +: 1/1/1 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
14 | SSA_0027 | Acyl carrier protein, putative | SSA_0028 | Phosphoribosylaminoimidazole-succinocarboxamide synthase, putative | ->-> | 31863 | 32022 | 160 | 29.4% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
15 | SSA_0035 | Bifunctional purine biosynthesis protein purH, putative | SSA_0036 | Secreted protein, possible function in cell-wall metabolism (amidase), putative | -><- | 42018 | 42139 | 122 | 37.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
16 | SSA_0036 | Secreted protein, possible function in cell-wall metabolism (amidase), putative | SSA_0037 | Phosphoribosylamine-glycine ligase; phosphoribosyl glycinamide synthetase (GARS), putative | <--> | 44090 | 44411 | 322 | 32.9% | 0 | 0 | 0 | +: 1/1/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
17 | SSA_0037 | Phosphoribosylamine-glycine ligase; phosphoribosyl glycinamide synthetase (GARS), putative | SSA_0039 | Phosphoribosylaminoimidazole carboxylase, catalytic subunit, putative | ->-> | 45675 | 45972 | 298 | 38.6% | 0 | 0 | 0 | +: 0/1/0 | -: 0/2/0 | 1 | 6 | 130 | 287 | Result | cgtagtcgccaaacaagataatgatcaccgtggtgaaaagaccagaacagtgtatgttctggtctagggaaaatttgagactttaggctcaaattttaggaatgaaaccgaaggtttgcttccgacccaccacttaaaaccattatcaaaaagaaaaa |
19 | SSA_0042 | Amino acid recemase, putative | SSA_0043 | hypothetical protein | ->-> | 48732 | 48940 | 209 | 45.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
20 | SSA_0044 | hypothetical protein | SSA_0045 | hypothetical protein | ->-> | 50318 | 50472 | 155 | 27.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
21 | SSA_0048 | Transcriptional regulator, TetR/AcrR family, putative | SSA_0049 | Dihydroxyacetone kinase (Dak1), putative | <--> | 53534 | 53751 | 218 | 33.5% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
22 | SSA_0051 | Dihydroxyacetone kinase phosphotransfer protein, putative | SSA_0052 | Transcriptional regulator, GntR family, putative | -><- | 55705 | 56031 | 327 | 28.4% | 0 | 0 | 0 | +: 1/1/1 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
23 | SSA_0052 | Transcriptional regulator, GntR family, putative | SSA_0053 | Beta-galactosidase, putative | <--> | 56749 | 56887 | 139 | 23.7% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
24 | SSA_0057 | Phosphotransferase system sugar-specific EII component, putative | SSA_0060 | Tagatose-6-phosphate ketose/aldose isomerase, putative | ->-> | 61307 | 61616 | 310 | 46.5% | 0 | 0 | 0 | +: 0/2/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
25 | SSA_0062 | Aldose 1-epimerase, putative | SSA_0063 | Holliday junction DNA helicase ruvB, putative | ->-> | 64919 | 65474 | 556 | 34.4% | 0 | 0 | 0 | +: 2/2/1 | -: 2/6/2 | 2 | 0 | 0 | 0 | Result | |
26 | SSA_0064 | hypothetical protein | SSA_0065 | Low molecular weight phosphotyrosine protein phosphatase, putative | ->-> | 67040 | 67314 | 275 | 31.3% | 0 | 0 | 0 | +: 0/4/0 | -: 1/2/2 | 1 | 0 | 0 | 0 | Result | |
27 | SSA_0067 | Acyltransferase (yrhL-like subfamily of SGNH-hydrolases), putative | SSA_0068 | Alcohol-acetaldehyde dehydrogenase, putative | ->-> | 69951 | 70253 | 303 | 26.7% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
28 | SSA_0068 | Alcohol-acetaldehyde dehydrogenase, putative | SSA_0069 | Hypothetical protein, possibly membrane-associated | ->-> | 72909 | 73176 | 268 | 45.9% | 0 | 0 | 0 | +: 0/1/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
29 | SSA_0069 | Hypothetical protein, possibly membrane-associated | SSA_0070 | Acetylxylan esterase, putative | ->-> | 73858 | 73972 | 115 | 36.5% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
30 | SSA_0070 | Acetylxylan esterase, putative | SSA_0071 | N-acetylmannosamine-6-p hosphate 2-epimerase 1, putative | ->-> | 74975 | 75349 | 375 | 35.5% | 0 | 0 | 0 | +: 1/3/3 | -: 1/3/0 | 1 | 0 | 0 | 0 | Result | |
31 | SSA_0081 | Transcriptional regulator, RpiR family (phosphosugar-binding), putative | SSA_0083 | hypothetical protein | <--> | 85162 | 85576 | 415 | 33.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
32 | SSA_0085 | V-type sodium ATPase, subunit I, putative | SSA_0086 | V-type sodium ATPase, subunit K, putative | ->-> | 87846 | 87978 | 133 | 30.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
33 | SSA_0093 | V-type sodium ATPase, subunit D, putative | SSA_0094 | Cell wall metabolism, LysM type protein, putative | ->-> | 95050 | 95484 | 435 | 36.8% | 0 | 0 | 0 | +: 0/3/0 | -: 1/4/0 | 1 | 0 | 0 | 0 | Result | |
34 | SSA_0094 | Cell wall metabolism, LysM type protein, putative | SSA_0095 | Threonine synthase, putative | ->-> | 96583 | 96694 | 112 | 33% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
35 | SSA_0095 | Threonine synthase, putative | SSA_0097 | Multi antimicrobial extrusion (MATE) family transporter, putative | ->-> | 98180 | 98287 | 108 | 35.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
36 | SSA_0099 | hypothetical protein | SSA_0100 | DNA polymerase I - 3'-5' exonuclease and polymerase domains, putative | <--> | 100710 | 100819 | 110 | 31.8% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
37 | SSA_0100 | DNA polymerase I - 3'-5' exonuclease and polymerase domains, putative | SSA_0101 | Conserved uncharacterized protein | ->-> | 103463 | 103735 | 273 | 37.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/3/0 | 1 | 0 | 0 | 0 | Result | |
38 | SSA_0103 | Integral membrane protein, putative | SSA_0104 | Queuine tRNA-ribosyltransferase, putative | <--> | 105581 | 105732 | 152 | 38.2% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
39 | SSA_0105 | Uridine kinase, putative | SSA_0106 | 30S ribosomal protein S10, putative | ->-> | 107540 | 107911 | 372 | 34.1% | 0 | 0 | 0 | +: 2/0/0 | -: 1/0/0 | 1 | 19 | 198 | 372 | Result | caaatcccttgcaatgactggttctttgtgttaagatactatggtgctgtaaaaatacagcgtgtagctttgatgcaagaggttgcgacacgctcggttgcattgccacgcaatcacctgtcggttttcttgtggagctagcctattatcttaaatagacgaaaaggagaaaaag |
40 | SSA_2391 | 30S ribosomal protein S14, putative | SSA_0120 | 30S ribosomal protein S8, putative | ->-> | 114578 | 114757 | 180 | 39.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
41 | SSA_0120 | 30S ribosomal protein S8, putative | SSA_0121 | hypothetical protein | ->-> | 115157 | 115322 | 166 | 34.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 11 | 5 | 114 | Result | aagatacaaagagcgtcatgggcaatgtgaaaataggaaatctgacaaagagtgttaacactctaggaagatttgtctttttcacacagaccatagctcgtgttcaattt |
42 | SSA_0125 | 50S ribosomal protein L30, putative | SSA_0126 | 50S ribosomal protein L15, putative | ->-> | 117253 | 117406 | 154 | 33.8% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
43 | SSA_0127 | Multispanning membrane protein, translocator of proteins, putative | SSA_0128 | Adenylate kinase, putative | ->-> | 119168 | 119340 | 173 | 32.9% | 0 | 0 | 0 | +: 0/2/0 | -: 0/3/0 | 1 | 0 | 0 | 0 | Result | |
44 | SSA_0128 | Adenylate kinase, putative | SSA_0129 | Translation initiation factor IF-1, putative | ->-> | 119980 | 120096 | 117 | 35.9% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
49 | SSA_0138 | Metal-binding (Zn) permease, putative | SSA_0139 | Copper transport operon or penicillinase transcriptional repressor, putative | ->-> | 134176 | 134322 | 147 | 27.9% | 0 | 0 | 0 | +: 1/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
50 | SSA_0141 | Copper chaperone, putative | SSA_0142 | hypothetical protein | ->-> | 137252 | 137369 | 118 | 37.3% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
51 | SSA_0143 | Conserved uncharacterized protein | SSA_0144 | Transcriptional regulator, TetR family, putative | -><- | 137941 | 138082 | 142 | 35.2% | 0 | 0 | 0 | +: 0/2/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
52 | SSA_0144 | Transcriptional regulator, TetR family, putative | SSA_0145 | Transcriptional regulator, TetR family, putative | <-<- | 138656 | 138867 | 212 | 29.2% | 0 | 0 | 0 | +: 1/0/0 | -: 1/1/0 | 1 | 0 | 0 | 0 | Result | |
53 | SSA_0145 | Transcriptional regulator, TetR family, putative | SSA_0146 | DNA repair ATPase, putative | <--> | 139471 | 139825 | 355 | 27.3% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
55 | SSA_0148 | Sugar ABC transporter, ATP-binding protein, putative | SSA_0149 | hypothetical protein | ->-> | 143528 | 143713 | 186 | 35.5% | 0 | 0 | 0 | +: 1/0/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
56 | SSA_0149 | hypothetical protein | SSA_0150 | hypothetical protein | ->-> | 143894 | 144075 | 182 | 30.8% | 0 | 0 | 0 | +: 1/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
57 | SSA_0150 | hypothetical protein | SSA_0151 | hypothetical protein | ->-> | 145288 | 145493 | 206 | 37.4% | 0 | 0 | 0 | +: 0/1/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
58 | SSA_0153 | hypothetical protein | SSA_0154 | hypothetical protein | ->-> | 149564 | 149975 | 412 | 35% | 0 | 0 | 0 | +: 0/4/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
59 | SSA_0156 | ATPase with chaperone activity, ATP-binding subunit, putative | SSA_0157 | hypothetical protein | ->-> | 153383 | 153652 | 270 | 33.3% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
60 | SSA_0159 | hypothetical protein | SSA_0160 | hypothetical protein | ->-> | 157117 | 158874 | 1758 | 36.7% | 0 | 0 | 0 | +: 3/5/8 | -: 3/4/2 | 2 | 0 | 0 | 0 | Result | |
61 | SSA_0166 | hypothetical protein | SSA_0167 | Hypothetical protein (Asparagine/proline-rich) | ->-> | 165207 | 165393 | 187 | 33.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
62 | SSA_0167 | Hypothetical protein (Asparagine/proline-rich) | SSA_0168 | hypothetical protein | ->-> | 166396 | 166596 | 201 | 27.4% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
63 | SSA_0168 | hypothetical protein | SSA_0169 | hypothetical protein | ->-> | 167578 | 167880 | 303 | 34% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
64 | SSA_0169 | hypothetical protein | SSA_0170 | hypothetical protein | -><- | 168076 | 168219 | 144 | 38.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
65 | SSA_0171 | Cro-like transcriptional repressor, XRE family, putative | SSA_0172 | Transcriptional regulator, XRE family, putative | <--> | 169047 | 169279 | 233 | 24.5% | 0 | 0 | 0 | +: 1/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
66 | SSA_0174 | Tyrosyl-tRNA synthetase 1, putative | SSA_0134 | Membrane carboxypeptidase (penicillin-binding protein), putative | <--> | 171979 | 172129 | 151 | 27.8% | 0 | 0 | 0 | +: 1/0/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
67 | SSA_0175 | Penicillin-binding protein 1B, putative | SSA_0176 | DNA-directed RNA polymerase I, beta chain (140 kDa subunit), putative | ->-> | 174545 | 175120 | 576 | 34.4% | 0 | 0 | 50 | +: 1/4/0 | -: 0/1/0 | 1 | 1 | 84 | 195 | Result | atttgtcgtgtgctttatttgaaatattgtccaaatagaagcttacagcagttaaatcaaacttgaataagtcagatttagctgctctttttgtgcctatttttaggaaaaa |
68 | SSA_0177 | DNA-directed RNA polymerase I, beta chain (160 kDa subunit), putative | SSA_0178 | UDP-N-acetylglucosamine 2-epimerase, putative | ->-> | 182193 | 182955 | 763 | 27.8% | 0 | 0 | 0 | +: 1/0/0 | -: 2/0/0 | 1 | 0 | 0 | 0 | Result | |
69 | SSA_0182 | Endoglucanase, putative | SSA_0183 | hypothetical protein | ->-> | 187468 | 187785 | 318 | 32.4% | 0 | 0 | 0 | +: 1/3/0 | -: 1/4/0 | 1 | 0 | 0 | 0 | Result | |
71 | SSA_0192 | Acetate kinase, putative | SSA_0193 | CAAX amino terminal protease family protein, putative | ->-> | 194243 | 194457 | 215 | 33% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
72 | SSA_0193 | CAAX amino terminal protease family protein, putative | SSA_0195 | hypothetical protein | ->-> | 195136 | 195252 | 117 | 35% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
73 | SSA_0195 | hypothetical protein | SSA_0197 | Dihydropteroate synthase, putative | ->-> | 195892 | 196085 | 194 | 39.2% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
74 | SSA_0205 | NisK (sensor-receptor histidine kinase domain), putative | SSA_2393 | Transcriptional regulator, XRE family, putative | ->-> | 203900 | 204195 | 296 | 41.2% | 0 | 0 | 0 | +: 1/1/0 | -: 0/2/0 | 2 | 1 | 30 | 142 | Result | gagtgggacagaaatcggtaattcgttagaattcgatttcgtcgtcccacctccgcacagttgagtagggctgtaaaagctgatgaaatcagcgtagtagagcccactcaacc |
75 | SSA_0208 | Conserved uncharacterized protein | SSA_0209 | Glutamyl aminopeptidase, putative | <-<- | 206543 | 206661 | 119 | 35.3% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
76 | SSA_0209 | Glutamyl aminopeptidase, putative | SSA_0210 | hypothetical protein | <--> | 207727 | 207896 | 170 | 39.4% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
77 | SSA_0212 | Phenylalanyl-tRNA synthetase, beta subunit, putative | SSA_0213 | hypothetical protein | -><- | 209140 | 209637 | 498 | 28.9% | 0 | 0 | 0 | +: 0/1/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
78 | SSA_0213 | hypothetical protein | SSA_0214 | Single-strand DNA-binding protein (conjugal DNA-protein transfer system), putative | <--> | 210226 | 210354 | 129 | 34.1% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
79 | SSA_0214 | Single-strand DNA-binding protein (conjugal DNA-protein transfer system), putative | SSA_0215 | Periplasmic sugar-binding protein (ribose porter), putative | ->-> | 210751 | 211030 | 280 | 34.3% | 0 | 0 | 0 | +: 2/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
80 | SSA_0218 | Sugar-binding periplasmic protein, putative | SSA_0219 | PTS system, sugar-specific enzyme IIA component, putative | ->-> | 215287 | 215506 | 220 | 34.5% | 0 | 0 | 0 | +: 0/1/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
81 | SSA_0224 | hypothetical protein | SSA_0225 | 10 kDa chaperonin | ->-> | 218579 | 218781 | 203 | 32.5% | 0 | 0 | 0 | +: 0/1/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
82 | SSA_0226 | 60 kDa chaperonin | SSA_0227 | Collagen-binding surface protein, putative | ->-> | 220710 | 221176 | 467 | 25.7% | 0 | 0 | 0 | +: 1/2/2 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
83 | SSA_0227 | Collagen-binding surface protein, putative | SSA_0228 | hypothetical protein | ->-> | 223031 | 223502 | 472 | 34.5% | 0 | 0 | 0 | +: 0/0/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
84 | SSA_0229 | hypothetical protein | SSA_0230 | hypothetical protein | -><- | 223774 | 223901 | 128 | 37.5% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
85 | SSA_0230 | hypothetical protein | SSA_0231 | Conserved uncharacterized protein | <--> | 225048 | 225852 | 805 | 31.1% | 0 | 0 | 0 | +: 1/5/4 | -: 1/6/6 | 1 | 2 | 188 | 805 | Result | tacacaaaaaagcctagtaaatcaaggctttttcctgttgtatttagatgccccctacagggatttggaaaggactttcatattgagagcaattaaaaatattgaaatataagtgattttaggtattttcaatgtcatgatttaaaaatgggacaaaagtggggcaaaaaccatacagattctaaactgtatggttctttttttatctaaccaagaaaggttaaaacttattaaaacaaatgcaatcaactgttgaaaactttttagtccgtgtaatataaaaacaagtaaaaagttgaactatagggaatattgtgtcataataggtaatagatgaataattaatagattggaaataatgctttcttaccttaacaagttgaattggttatacattttttcgtcgcaattgtgtctatctctcgagtttagctagtttttataagctctggtttctaatcaatataacaaattttagaagtgcataagacaagatggtgacattactacagtcatttctagtcaccatatgttgctggcacaggctgtttgtagtgttggctatttactagtcagtttaatcggagtgtttaatttttattgttgaaaggtttttat |
87 | SSA_0234 | hypothetical protein | SSA_0235 | Integrase/recombinase, phage associated, putative | <--> | 229029 | 229700 | 672 | 31.4% | 0 | 0 | 9 | +: 2/3/6 | -: 1/2/2 | 1 | 0 | 0 | 0 | Result | |
89 | SSA_0240 | Acetyltransferase, GNAT family, putative | SSA_0241 | Ribosomal protein L11 methyltransferase, putative | ->-> | 234021 | 234160 | 140 | 36.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 4 | 7 | 137 | Result | aaaggattgttcagttaaatttctaaactgaacccgccctaaacactgtggcaaaaagataaaattctcttagacgcaaacgtcgtcagagaatttcctgttttggatttgtgttttacgggcttggtatt |
90 | SSA_0243 | Cyclo-nucleotide phosphodiesterase, putative | SSA_0244 | hypothetical protein | <--> | 238326 | 238837 | 512 | 35.5% | 0 | 0 | 0 | +: 1/2/0 | -: 1/1/1 | 1 | 0 | 0 | 0 | Result | |
91 | SSA_0245 | hypothetical protein | SSA_0246 | Conserved uncharacterized protein | ->-> | 239669 | 239842 | 174 | 27.6% | 0 | 0 | 0 | +: 2/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
92 | SSA_0249 | hypothetical protein | SSA_0250 | GTP pyrophosphokinase, putative | ->-> | 242176 | 242306 | 131 | 44.3% | 0 | 0 | 0 | +: 1/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
93 | SSA_0252 | hypothetical protein | SSA_0253 | CAAX amino terminal protease family protein, putative | <--> | 245930 | 246428 | 499 | 30.9% | 0 | 0 | 0 | +: 0/0/0 | -: 2/0/0 | 1 | 0 | 0 | 0 | Result | |
94 | SSA_0253 | CAAX amino terminal protease family protein, putative | SSA_0254 | hypothetical protein | -><- | 247044 | 247156 | 113 | 34.5% | 0 | 0 | 0 | +: 0/1/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
95 | SSA_0255 | Multiple antibiotic resistance operon transcription repressor (MarR), putative | SSA_0256 | Metalloregulator ScaR (Fe/Mn-dependent transcriptional repressor), putative | <-<- | 248037 | 248141 | 105 | 31.4% | 0 | 0 | 0 | +: 0/0/0 | -: 1/1/0 | 1 | 0 | 0 | 0 | Result | |
96 | SSA_0256 | Metalloregulator ScaR (Fe/Mn-dependent transcriptional repressor), putative | SSA_0257 | N-acetylmuramidase/lysin, putative | <--> | 248790 | 249017 | 228 | 29.8% | 0 | 0 | 0 | +: 1/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
98 | SSA_0262 | ABC-type Mn/Zn transporter, ATP-ase component, putative | SSA_0263 | Zinc metalloproteinase in scaA 5'region, putative | <--> | 256295 | 256413 | 119 | 19.3% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
99 | SSA_0263 | Zinc metalloproteinase in scaA 5'region, putative | SSA_0264 | PEP phosphonomutase-like protein, putative | ->-> | 258307 | 258539 | 233 | 28.8% | 0 | 0 | 0 | +: 1/1/1 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
101 | SSA_0267 | ROK family protein, putative | SSA_0268 | Phosphotransferase system (PTS) cellobiose-specific component IIB, putative | <--> | 262160 | 262363 | 204 | 29.4% | 0 | 0 | 0 | +: 1/1/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
102 | SSA_0272 | Oxidoreductase, aldo/keto reductase family, putative | SSA_0273 | hypothetical protein | ->-> | 267093 | 267210 | 118 | 36.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
103 | SSA_0274 | hypothetical protein | SSA_0276 | Glycosyltransferase, family 2/glycosyltransferase family 8, putative | <--> | 269648 | 269857 | 210 | 28.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
104 | SSA_0279 | Sugar-binding transcriptional repressor (DeoR), putative | SSA_0281 | hypothetical protein | ->-> | 273431 | 273543 | 113 | 38.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
105 | SSA_0281 | hypothetical protein | SSA_0282 | Phosphotransferase system (PTS), cellobiose-specific IIA component, putative | ->-> | 274024 | 274354 | 331 | 31.7% | 0 | 0 | 0 | +: 0/2/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
106 | SSA_0284 | Phosphotransferase system (PTS), cellobiose-specific IIC component, putative | SSA_0285 | Formate acetyltransferase 3, putative | ->-> | 276330 | 276497 | 168 | 29.2% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
107 | SSA_0288 | hypothetical protein | SSA_0289 | Leucyl-tRNA synthetase, putative | <--> | 281394 | 281545 | 152 | 30.3% | 0 | 0 | 0 | +: 1/1/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
108 | SSA_0289 | Leucyl-tRNA synthetase, putative | SSA_0290 | hypothetical protein | -><- | 284060 | 284173 | 114 | 29.8% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
109 | SSA_0290 | hypothetical protein | SSA_0291 | Oxidoreductase, putative | <--> | 285320 | 285501 | 182 | 33% | 0 | 0 | 0 | +: 1/3/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
110 | SSA_0292 | Transcriptional regulator, AraC family (arabinose operon control), putative | SSA_0293 | hypothetical protein | -><- | 287323 | 287445 | 123 | 43.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
112 | SSA_0294 | hypothetical protein | SSA_0295 | Transcriptional regulator, LysR family, putative | <-<- | 287967 | 288115 | 149 | 32.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
113 | SSA_0295 | Transcriptional regulator, LysR family, putative | SSA_0296 | Transcriptional regulator, XRE family, putative | <-<- | 288992 | 289102 | 111 | 36% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
114 | SSA_0296 | Transcriptional regulator, XRE family, putative | SSA_0297 | Malolactic enzyme, putative | <--> | 289454 | 289845 | 392 | 28.1% | 0 | 0 | 0 | +: 0/0/0 | -: 2/0/0 | 1 | 0 | 0 | 0 | Result | |
115 | SSA_0298 | Malate permease, putative | SSA_0299 | hypothetical protein | ->-> | 292508 | 292898 | 391 | 36.8% | 0 | 0 | 3 | +: 1/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
116 | SSA_0299 | hypothetical protein | SSA_0300 | hypothetical protein | ->-> | 293403 | 293558 | 156 | 23.7% | 0 | 0 | 0 | +: 1/1/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
117 | SSA_0301 | hypothetical protein | SSA_0302 | Phosphoglycerate kinase, putative | ->-> | 294814 | 295029 | 216 | 31% | 0 | 0 | 0 | +: 0/2/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
118 | SSA_0302 | Phosphoglycerate kinase, putative | SSA_0303 | surface protein C | ->-> | 296227 | 296590 | 364 | 33.2% | 0 | 0 | 0 | +: 1/1/1 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
119 | SSA_0303 | surface protein C | SSA_0304 | Bacterial cell wall degradation (CHAP/LysM domains), putative | ->-> | 301112 | 301282 | 171 | 27.5% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
120 | SSA_0304 | Bacterial cell wall degradation (CHAP/LysM domains), putative | SSA_0305 | hypothetical protein | ->-> | 301949 | 302124 | 176 | 39.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
121 | SSA_0313 | Conserved uncharacterized protein | SSA_0314 | Nucleoside-diphosphate-sugar epimerase, putative | <-<- | 308710 | 309056 | 347 | 36% | 0 | 0 | 0 | +: 1/1/1 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
122 | SSA_0314 | Nucleoside-diphosphate-sugar epimerase, putative | SSA_0315 | Transcriptional regulator, MarR family, putative | <--> | 310110 | 310241 | 132 | 26.5% | 0 | 0 | 0 | +: 1/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
123 | SSA_0320 | hypothetical protein | SSA_0321 | Methylase, putative | ->-> | 313885 | 314006 | 122 | 32% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
124 | SSA_0321 | Methylase, putative | SSA_0322 | Transcriptional activator, TipA family, putative | ->-> | 314754 | 314856 | 103 | 35.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
125 | SSA_0322 | Transcriptional activator, TipA family, putative | SSA_0323 | Flavoprotein, putative | -><- | 315595 | 315713 | 119 | 32.8% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
126 | SSA_0323 | Flavoprotein, putative | SSA_0324 | Conserved uncharacterized protein | <--> | 316890 | 317158 | 269 | 32% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
127 | SSA_0325 | Membrane-anchored glycerophosphoryl diester phosphodiesterase, putative | SSA_0326 | Conserved uncharacterized BCR, YbaB family | -><- | 319498 | 319613 | 116 | 37.9% | 0 | 0 | 0 | +: 1/1/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
128 | SSA_0326 | Conserved uncharacterized BCR, YbaB family | SSA_0327 | Glycosyltransferase, putative | <--> | 319914 | 320118 | 205 | 32.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
129 | SSA_0328 | Xaa-Pro dipeptidyl-peptidase, putative | SSA_0329 | Glycerol uptake facilitator/aquaporin protein, putative | <--> | 322866 | 322969 | 104 | 22.1% | 0 | 0 | 0 | +: 1/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
130 | SSA_0332 | hypothetical protein | SSA_0333 | Mevalonate kinase, putative | ->-> | 326985 | 327134 | 150 | 37.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
131 | SSA_0338 | Hydroxymethylglutaryl-CoA synthase, putative | SSA_0339 | hypothetical protein | <-<- | 333429 | 333572 | 144 | 27.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
132 | SSA_0341 | hypothetical protein | SSA_0342 | Pyruvate formate-lyase, putative | <-<- | 334822 | 334980 | 159 | 35.2% | 0 | 0 | 0 | +: 0/2/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
133 | SSA_0342 | Pyruvate formate-lyase, putative | SSA_0343 | DNA-damage-inducible protein P, putative | <--> | 337297 | 337664 | 368 | 29.9% | 0 | 0 | 0 | +: 2/1/2 | -: 2/1/1 | 1 | 0 | 0 | 0 | Result | |
134 | SSA_0343 | DNA-damage-inducible protein P, putative | SSA_0345 | hypothetical protein | ->-> | 338730 | 338942 | 213 | 31% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
135 | SSA_0345 | hypothetical protein | SSA_0346 | hypothetical protein | ->-> | 339270 | 339587 | 318 | 36.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
136 | SSA_0352 | Ribonuclease HIII, putative | SSA_0353 | Conserved uncharacterized protein | <--> | 345970 | 346079 | 110 | 30.9% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
137 | SSA_0357 | Thioredoxin, putative | SSA_0358 | hypothetical protein | -><- | 351218 | 351377 | 160 | 36.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
138 | SSA_0358 | hypothetical protein | SSA_0359 | Trancriptional regulator, LysR-family, putative | <--> | 351888 | 352326 | 439 | 25.7% | 0 | 0 | 69 | +: 0/2/0 | -: 1/1/0 | 1 | 0 | 0 | 0 | Result | |
139 | SSA_0359 | Trancriptional regulator, LysR-family, putative | SSA_0360 | Conserved uncharacterized protein | ->-> | 352744 | 352843 | 100 | 22% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
140 | SSA_0360 | Conserved uncharacterized protein | SSA_0362 | Thioredoxin, putative | ->-> | 353252 | 353429 | 178 | 33.1% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
141 | SSA_0362 | Thioredoxin, putative | SSA_0363 | D-alanine/glycine/Na permease, putative | ->-> | 353655 | 353997 | 343 | 42% | 0 | 0 | 0 | +: 1/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
142 | SSA_0364 | Serine/threonine:Na+ symporter, putative | SSA_0365 | Small-conductance mechanosensitive efflux channel, putative | <--> | 356439 | 356760 | 322 | 46.3% | 0 | 0 | 1 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
143 | SSA_0366 | hypothetical protein | SSA_0367 | hypothetical protein | ->-> | 358273 | 358448 | 176 | 35.2% | 0 | 0 | 0 | +: 1/1/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
144 | SSA_0371 | NADP-specific glutamate dehydrogenase, putative | SSA_0373 | Dihydroorotate dehydrogenase, putative | <--> | 361850 | 362201 | 352 | 33.8% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
145 | SSA_0373 | Dihydroorotate dehydrogenase, putative | SSA_0374 | Peptide methionine sulfoxide reductase msrA/msrB, putative | ->-> | 363141 | 363302 | 162 | 30.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
146 | SSA_0374 | Peptide methionine sulfoxide reductase msrA/msrB, putative | SSA_0375 | D-methionine-binding lipoprotein (ABC-type transporter), putative | ->-> | 364239 | 364396 | 158 | 25.9% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
147 | SSA_0375 | D-methionine-binding lipoprotein (ABC-type transporter), putative | SSA_0376 | ABC-type methionine transporter, ATPase component, putative | ->-> | 365270 | 365518 | 249 | 38.6% | 0 | 0 | 0 | +: 0/1/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
148 | SSA_0377 | ABC-type methionine transporter, permease component, putative | SSA_0378 | TRZ/ATZ family hydrolase, putative | ->-> | 367279 | 367415 | 137 | 39.4% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
149 | SSA_0378 | TRZ/ATZ family hydrolase, putative | SSA_0379 | PTS system, beta-glucoside-specific EII component, putative | ->-> | 368688 | 368961 | 274 | 35.4% | 0 | 0 | 0 | +: 1/1/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
150 | SSA_0379 | PTS system, beta-glucoside-specific EII component, putative | SSA_0380 | Enzyme of poly-gamma-glutamate biosynthesis (capsule formation), putative | ->-> | 370894 | 371055 | 162 | 38.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
151 | SSA_0380 | Enzyme of poly-gamma-glutamate biosynthesis (capsule formation), putative | SSA_0381 | hypothetical protein | ->-> | 372439 | 372902 | 464 | 33.8% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
152 | SSA_0381 | hypothetical protein | SSA_0382 | Transcriptional regulator, AraC family (arabinose-binding/dimerisation), putative | -><- | 373575 | 373689 | 115 | 28.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
153 | SSA_0382 | Transcriptional regulator, AraC family (arabinose-binding/dimerisation), putative | SSA_0383 | Beta-glucosidase, putative | <--> | 374563 | 374673 | 111 | 25.2% | 0 | 0 | 0 | +: 1/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
154 | SSA_0383 | Beta-glucosidase, putative | SSA_0384 | hypothetical protein | ->-> | 376114 | 376379 | 266 | 30.8% | 0 | 0 | 0 | +: 0/1/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
155 | SSA_0384 | hypothetical protein | SSA_0385 | ABC transporter, glycine-betaine/proline permease protein, putative | -><- | 378510 | 378615 | 106 | 40.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
156 | SSA_0386 | Glycine-betaine ABC transporter, ATPase component, putative | SSA_0387 | Transcriptional regulator, GntR family, putative | <-<- | 381546 | 381791 | 246 | 35.8% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
157 | SSA_0387 | Transcriptional regulator, GntR family, putative | SSA_0388 | Mismatch repair ATPase (MutS family), putative | <--> | 382434 | 382613 | 180 | 34.4% | 0 | 0 | 0 | +: 1/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
158 | SSA_0390 | hypothetical protein | SSA_0391 | Pyruvate oxidase, putative | ->-> | 385775 | 386085 | 311 | 28.3% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
159 | SSA_0391 | Pyruvate oxidase, putative | SSA_0392 | hypothetical protein | ->-> | 387862 | 388015 | 154 | 41.6% | 0 | 0 | 0 | +: 0/2/0 | -: 0/0/0 | 1 | 1 | 1 | 154 | Result | ttcctctcgccgaaaatcaaatgtaaactgtgtcatcttaaccttgccgtacagcagtactgcctgcggttcgatgtcttgtttataacttgattttcttagagcggaacttgaaaagatcggagcaatccggtctttttatggaggatagtaa |
160 | SSA_0392 | hypothetical protein | SSA_0393 | Bacteriocin ABC-type exporter, ATP binding/permease protein, putative | ->-> | 388364 | 388905 | 542 | 26.9% | 0 | 0 | 0 | +: 2/1/0 | -: 1/2/0 | 1 | 0 | 0 | 0 | Result | |
161 | SSA_0393 | Bacteriocin ABC-type exporter, ATP binding/permease protein, putative | SSA_0394 | hypothetical protein | ->-> | 390481 | 390712 | 232 | 25.4% | 0 | 0 | 0 | +: 1/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
162 | SSA_0394 | hypothetical protein | SSA_0395 | 6-phospho-beta-glucosidase, putative | ->-> | 390992 | 391200 | 209 | 27.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 1 | 68 | 206 | Result | agaggataatttttaaaaaatgatctgatcaacttaaatagtagaatagtatcagtatgtaacaatattttataagaaaaggtttacataatgagctataatataagtaaatgaacaagcaaataagaaagcgagtaga |
163 | SSA_0396 | hypothetical protein | SSA_0397 | hypothetical protein | <-<- | 393686 | 394081 | 396 | 36.6% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
164 | SSA_0400 | hypothetical protein | SSA_0401 | Two-component response transcriptional regulator (CheY-like receiver and winged-helix DNA-binding domains), putative | <--> | 398342 | 398601 | 260 | 31.5% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
165 | SSA_0402 | Histidine kinase, putative | SSA_0403 | CAAX amino terminal protease family, putative | ->-> | 400160 | 400614 | 455 | 35.6% | 0 | 0 | 0 | +: 0/2/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
166 | SSA_0403 | CAAX amino terminal protease family, putative | SSA_0405 | Transcriptional regulator, XRE family, putative | ->-> | 401449 | 401557 | 109 | 33% | 0 | 0 | 0 | +: 1/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
167 | SSA_0405 | Transcriptional regulator, XRE family, putative | SSA_0406 | hypothetical protein | -><- | 402176 | 402285 | 110 | 37.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
168 | SSA_0407 | ABC-type multidrug transport system (3-component subtilin immunity exporter), ATPase component, putative | SSA_0408 | hypothetical protein | <-<- | 403934 | 404078 | 145 | 22.8% | 0 | 0 | 0 | +: 1/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
169 | SSA_0409 | ABC-type multidrug transport system, ATPase component, putative | SSA_0410 | hypothetical protein | <-<- | 405696 | 405839 | 144 | 30.6% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
170 | SSA_0412 | ABC-type multidrug transport system (3-component subtilin immunity exporter), ATPase component, putative | SSA_0413 | Anthranilate/para-aminobenzoate synthases component I/ Chorismate binding enzyme, putative | <-<- | 408254 | 408404 | 151 | 32.5% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
171 | SSA_0413 | Anthranilate/para-aminobenzoate synthases component I/ Chorismate binding enzyme, putative | SSA_0414 | hypothetical protein | <--> | 410127 | 410257 | 131 | 26% | 0 | 0 | 0 | +: 0/1/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
172 | SSA_0415 | Permease, putative | SSA_0416 | 5-methyltetrahydropteroyltriglutamate-- homocysteine methyltransferase, putative | ->-> | 411791 | 412029 | 239 | 34.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
173 | SSA_0416 | 5-methyltetrahydropteroyltriglutamate-- homocysteine methyltransferase, putative | SSA_0417 | 5,10-methylenetetrahydrofolate reductase, putative | ->-> | 414283 | 414419 | 137 | 40.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
174 | SSA_0418 | AraC-type DNA-binding domain-containing protein, putative | SSA_0419 | Alpha-galactosidase, putative | ->-> | 416245 | 416352 | 108 | 36.1% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
175 | SSA_0419 | Alpha-galactosidase, putative | SSA_0420 | Hydrolase, HAD superfamily, putative | ->-> | 418591 | 418759 | 169 | 30.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
176 | SSA_0425 | Glycosyltransferase, putative | SSA_0426 | hypothetical protein | <-<- | 423370 | 423654 | 285 | 31.2% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
177 | SSA_0426 | hypothetical protein | SSA_0427 | DNA-binding transcriptional activator, SARP family, putative | <--> | 424477 | 424636 | 160 | 27.5% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
178 | SSA_0428 | Formimidoylglutamase, putative | SSA_0429 | Histidine ammonia-lyase, putative | <-<- | 428895 | 429790 | 896 | 37.7% | 0 | 0 | 0 | +: 0/3/0 | -: 1/1/0 | 1 | 0 | 0 | 0 | Result | |
179 | SSA_0434 | Glutamate formiminotransferase, putative | SSA_0435 | Urocanate hydratase, putative | <-<- | 436659 | 436778 | 120 | 37.5% | 0 | 0 | 0 | +: 1/0/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
180 | SSA_0435 | Urocanate hydratase, putative | SSA_0436 | Imidazolonepropionase, putative | <--> | 438810 | 439008 | 199 | 32.2% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
181 | SSA_0436 | Imidazolonepropionase, putative | SSA_0437 | 30S ribosomal protein S6, putative | ->-> | 440275 | 440452 | 178 | 40.4% | 0 | 0 | 0 | +: 1/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
182 | SSA_0441 | hypothetical protein | SSA_0442 | ABC-type multidrug transport system, ATPase component, putative | ->-> | 442236 | 442376 | 141 | 29.1% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
183 | SSA_0447 | Magnesium and cobalt transporter, putative | SSA_0448 | Excinuclease ATPase subunit A, putative | <--> | 446492 | 446619 | 128 | 35.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
184 | SSA_0448 | Excinuclease ATPase subunit A, putative | SSA_0449 | Aminopeptidase P; XAA-pro aminopeptidase, putative | ->-> | 449452 | 449603 | 152 | 33.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
185 | SSA_0452 | Nitrogen utilization substance protein B, putative | SSA_0453 | Type II secretory pathway, pullulanase PulA glycosidase, putative | ->-> | 452121 | 452351 | 231 | 31.6% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
186 | SSA_0455 | Sucrose-6-phosphate hydrolase, putative | SSA_0456 | Phosphotransferase system IIC components, glucose/maltose/N-acetylglucosamine-specific, putative | <--> | 458541 | 458734 | 194 | 26.3% | 0 | 0 | 0 | +: 0/1/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
187 | SSA_0456 | Phosphotransferase system IIC components, glucose/maltose/N-acetylglucosamine-specific, putative | SSA_0457 | Fructokinase, putative | ->-> | 460646 | 460802 | 157 | 28% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
188 | SSA_0459 | hypothetical protein | SSA_0460 | Multiple antibiotic resistance operon transcription repressor (MarR), putative | ->-> | 462574 | 462747 | 174 | 31.6% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
189 | SSA_0462 | ABC-type multidrug transport system (phospholipid, LPS, lipid A and drug exporter), ATPase and permease components, putative | SSA_0463 | Cobyrinic acid A,C-diamide synthase, putative | ->-> | 466713 | 467004 | 292 | 31.5% | 0 | 0 | 0 | +: 1/1/0 | -: 0/3/0 | 1 | 0 | 0 | 0 | Result | |
190 | SSA_0478 | Cobalt transport protein cbiN, putative | SSA_0479 | CbiQ protein, putative | ->-> | 480448 | 480564 | 117 | 49.6% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
191 | SSA_0492 | NADH-dependent flavin oxidoreductase, putative | SSA_0493 | ABC-type dipeptide/nickel transport system, periplasmic component, putative | ->-> | 492832 | 493007 | 176 | 37.5% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
192 | SSA_0498 | ABC-type dipeptide/oligopeptide/nickel transport systems, permease components, putative | SSA_0499 | ABC-type dipeptide transport system, periplasmic component, putative | ->-> | 498860 | 499054 | 195 | 32.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
193 | SSA_0500 | Peptide ABC transporter, permease protein, putative | SSA_0502 | Peptide ABC transporter, permease protein, putative | ->-> | 501585 | 501693 | 109 | 41.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
194 | SSA_0506 | Iron-sulfur cluster-binding protein, putative | SSA_0507 | hypothetical protein | <--> | 505720 | 505860 | 141 | 26.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
195 | SSA_0507 | hypothetical protein | SSA_0508 | Conserved uncharacterized protein, possible phosphoserine phosphatase | ->-> | 506503 | 506807 | 305 | 32.5% | 0 | 0 | 0 | +: 1/1/1 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
196 | SSA_0513 | ATP:cob(I)alamin adenosyltransferase, putative | SSA_0514 | PduQ protein, putative | ->-> | 512298 | 513016 | 719 | 33.1% | 0 | 0 | 0 | +: 1/2/2 | -: 1/2/0 | 1 | 0 | 0 | 0 | Result | |
197 | SSA_0514 | PduQ protein, putative | SSA_0515 | Propanediol utilization protein PduU, putative | ->-> | 514160 | 514273 | 114 | 30.7% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
199 | SSA_0525 | Microcompartment protein, putative | SSA_0526 | hypothetical protein | ->-> | 523903 | 524099 | 197 | 40.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
200 | SSA_0531 | Ethanolamine utilization protein eutQ (cobalamin-dependent degradation of ethanolamine), putative | SSA_0532 | Propanediol utilization protein PduB, putative | ->-> | 527945 | 528383 | 439 | 35.3% | 0 | 0 | 0 | +: 0/5/0 | -: 1/3/0 | 1 | 0 | 0 | 0 | Result | |
201 | SSA_0539 | PduO protein, putative | SSA_0540 | Glycerol uptake facilitator protein, putative | ->-> | 534928 | 535094 | 167 | 38.3% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
202 | SSA_0540 | Glycerol uptake facilitator protein, putative | SSA_0541 | Acetate kinase, putative | ->-> | 535809 | 535942 | 134 | 29.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
203 | SSA_0541 | Acetate kinase, putative | SSA_0543 | SecA, putative | ->-> | 537143 | 537418 | 276 | 33.7% | 0 | 0 | 0 | +: 1/2/2 | -: 1/1/0 | 1 | 0 | 0 | 0 | Result | |
204 | SSA_0546 | Phospho-2-dehydro-3-deoxyheptonate aldolase (DAHP synthatase), possibly tyr-sensitive, putative | SSA_0547 | Acyl carrier protein synthase, putative | ->-> | 542024 | 542130 | 107 | 48.6% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
205 | SSA_0548 | Alanine racemase, putative | SSA_0549 | ATP-dependent DNA helicase recG, transcription-repair coupling factor, putative | ->-> | 543590 | 543695 | 106 | 45.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
206 | SSA_0549 | ATP-dependent DNA helicase recG, transcription-repair coupling factor, putative | SSA_0551 | L-asparaginase, putative | -><- | 545712 | 546420 | 709 | 33.6% | 0 | 0 | 0 | +: 0/3/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
207 | SSA_0551 | L-asparaginase, putative | SSA_0552 | Cof family protein, putative | <--> | 547384 | 547563 | 180 | 26.1% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
208 | SSA_0559 | hypothetical protein | SSA_0560 | hypothetical protein | ->-> | 553180 | 553405 | 226 | 31.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
209 | SSA_0561 | RNA:NAD 2'-phosphotransferase, putative | SSA_0562 | hypothetical protein | ->-> | 554316 | 554607 | 292 | 28.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
210 | SSA_0562 | hypothetical protein | SSA_0563 | Universal stress protein family, putative | -><- | 554920 | 555036 | 117 | 35.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
211 | SSA_0563 | Universal stress protein family, putative | SSA_0564 | Potential aminotransferase, putative | <--> | 555490 | 555833 | 344 | 34.6% | 0 | 0 | 0 | +: 1/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
212 | SSA_0564 | Potential aminotransferase, putative | SSA_0565 | hypothetical protein | ->-> | 557049 | 557369 | 321 | 32.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/3/0 | 1 | 0 | 0 | 0 | Result | |
213 | SSA_0565 | hypothetical protein | SSA_0566 | GTP-sensing transcriptional pleiotropic repressor, putative | ->-> | 559956 | 560156 | 201 | 20.9% | 0 | 0 | 0 | +: 1/0/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
214 | SSA_0567 | Isochorismitase family protein, putative | SSA_0568 | Aspartyl-tRNA synthetase 1, putative | ->-> | 561503 | 561813 | 311 | 45.7% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
215 | SSA_0568 | Aspartyl-tRNA synthetase 1, putative | SSA_0569 | Aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit C, putative | ->-> | 563551 | 563752 | 202 | 36.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
216 | SSA_0571 | Aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B, putative | SSA_0572 | Dehydrogenase, putative | ->-> | 566955 | 567565 | 611 | 30.8% | 0 | 0 | 0 | +: 3/2/3 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
217 | SSA_0574 | YdjX protein, putative | SSA_0575 | Hydrolase, HAD superfamily, putative | <--> | 569518 | 569666 | 149 | 33.6% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
218 | SSA_0576 | Conserved GTPase, putative | SSA_0577 | Ancient RNA-binding IF3-C fold (CRS1/YhbY domain), putative | ->-> | 571286 | 571392 | 107 | 43% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
219 | SSA_0583 | Nucleotidyltransferase, putative | SSA_0584 | hypothetical protein | ->-> | 575740 | 575945 | 206 | 36.4% | 0 | 0 | 0 | +: 1/2/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
220 | SSA_0584 | hypothetical protein | SSA_0585 | hypothetical protein | ->-> | 576750 | 577076 | 327 | 40.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
221 | SSA_0585 | hypothetical protein | SSA_0586 | Conserved uncharacterized protein | ->-> | 577347 | 577586 | 240 | 32.9% | 0 | 0 | 0 | +: 1/1/1 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
222 | SSA_0586 | Conserved uncharacterized protein | SSA_0587 | Metal-dependent amidase/aminoacylase/carboxypeptidase, putative | ->-> | 578304 | 578678 | 375 | 38.9% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
223 | SSA_0587 | Metal-dependent amidase/aminoacylase/carboxypeptidase, putative | SSA_0588 | L-cystine ABC transporter, substrate-binding component, putative | ->-> | 579822 | 579939 | 118 | 30.5% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
224 | SSA_0588 | L-cystine ABC transporter, substrate-binding component, putative | SSA_0589 | Acetylornithine deacetylase/succinyl-diaminopimelate desuccinylase (M20/M25/M40 family peptidase), putative | ->-> | 580768 | 580884 | 117 | 42.7% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
225 | SSA_0592 | hypothetical protein | SSA_0593 | Rhodanese-like sulfurtransferase, putative | ->-> | 584309 | 584624 | 316 | 27.2% | 0 | 0 | 0 | +: 1/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
226 | SSA_0593 | Rhodanese-like sulfurtransferase, putative | SSA_0594 | Transcriptional regulator, AraC family, putative | ->-> | 585612 | 585769 | 158 | 29.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
227 | SSA_0596 | hypothetical protein | SSA_0597 | hypothetical protein | ->-> | 587413 | 587705 | 293 | 32.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
228 | SSA_0597 | hypothetical protein | SSA_0599 | hypothetical protein | ->-> | 588624 | 588806 | 183 | 34.4% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
229 | SSA_0599 | hypothetical protein | SSA_0601 | Phosphorylase, Pnp/Udp family, putative | ->-> | 589068 | 589286 | 219 | 42% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
230 | SSA_0609 | Transcriptional regulator, TetR/AcrR family, putative | SSA_0610 | LemA-like protein, putative | <--> | 598955 | 599107 | 153 | 28.1% | 0 | 0 | 0 | +: 1/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
231 | SSA_0611 | HtpX protease, putative | SSA_0612 | Rgg protein, putative | ->-> | 600576 | 601035 | 460 | 27.2% | 0 | 0 | 0 | +: 1/2/2 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
232 | SSA_0613 | Glucosyltransferase, putative | SSA_0614 | Transporter, putative | -><- | 606694 | 606822 | 129 | 28.7% | 0 | 0 | 0 | +: 0/2/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
233 | SSA_0614 | Transporter, putative | SSA_0615 | RggD, putative | <-<- | 608065 | 608415 | 351 | 34.5% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
235 | SSA_0617 | Membrane protease subunits, stomatin/prohibitin-like protein (SPFH domain/band 7 family), putative | SSA_0618 | hypothetical protein | -><- | 611499 | 611769 | 271 | 34.7% | 0 | 0 | 0 | +: 0/1/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
236 | SSA_0622 | Transcriptional regulator (XRE family), SOS-response transcriptional repressors (RecA-mediated autopeptidases), putative | SSA_0623 | hypothetical protein | <--> | 614510 | 614651 | 142 | 35.2% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
237 | SSA_0626 | hypothetical protein | SSA_0627 | hypothetical protein | ->-> | 617273 | 617453 | 181 | 33.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
238 | SSA_0629 | hypothetical protein | SSA_0631 | Tryptophan synthase beta chain, putative | ->-> | 619647 | 620011 | 365 | 36.2% | 0 | 0 | 0 | +: 1/1/0 | -: 0/0/0 | 2 | 0 | 0 | 0 | Result | |
239 | SSA_0631 | Tryptophan synthase beta chain, putative | SSA_0632 | Anthranilate synthase component I, putative | ->-> | 621194 | 621597 | 404 | 41.1% | 0 | 0 | 0 | +: 2/2/2 | -: 1/1/1 | 1 | 0 | 0 | 0 | Result | |
240 | SSA_0651 | hypothetical protein | SSA_0652 | UDP-N-acetylmuramoylalanine--D-glutamate ligase, putative | ->-> | 634958 | 635175 | 218 | 27.5% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
241 | SSA_0654 | Cell division protein DivIB, putative | SSA_0655 | Cell division protein FtsA, putative | ->-> | 638803 | 638923 | 121 | 31.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
243 | SSA_0660 | Cell division protein DivIVA, putative | SSA_0661 | Isoleucyl-tRNA synthetase, putative | ->-> | 644733 | 645015 | 283 | 39.9% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
244 | SSA_0661 | Isoleucyl-tRNA synthetase, putative | SSA_0662 | Multiple antibiotic resistance operon transcription repressor (MarR), putative | -><- | 647809 | 647936 | 128 | 28.1% | 0 | 0 | 0 | +: 1/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
245 | SSA_0669 | ATP dependent protease, putative | SSA_0670 | Conserved uncharacterized protein | <--> | 653811 | 654059 | 249 | 29.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
246 | SSA_0670 | Conserved uncharacterized protein | SSA_0671 | Methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase, putative | ->-> | 654291 | 654479 | 189 | 30.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
247 | SSA_0672 | hypothetical protein | SSA_0673 | hypothetical protein | ->-> | 656105 | 656211 | 107 | 43% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
248 | SSA_0673 | hypothetical protein | SSA_0674 | Exodeoxyribonuclease VII large subunit, putative | ->-> | 657055 | 657210 | 156 | 32.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
249 | SSA_0680 | Serine/threonine protein phosphatase, putative | SSA_0682 | Conserved uncharacterized protein | ->-> | 663294 | 663577 | 284 | 30.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
250 | SSA_0682 | Conserved uncharacterized protein | SSA_0683 | DNA-binding protein HU, putative | ->-> | 664412 | 664523 | 112 | 28.6% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
251 | SSA_0683 | DNA-binding protein HU, putative | SSA_0684 | Fibril-like structure subunit FibA, putative | ->-> | 664800 | 665131 | 332 | 28.9% | 0 | 0 | 0 | +: 1/2/2 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
252 | SSA_0684 | Fibril-like structure subunit FibA, putative | SSA_0685 | hypothetical protein | ->-> | 668954 | 669171 | 218 | 26.6% | 0 | 0 | 0 | +: 0/2/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
253 | SSA_0685 | hypothetical protein | SSA_0686 | Fe2+/Zn2+ uptake regulation protein, putative | ->-> | 669493 | 669695 | 203 | 35.5% | 0 | 0 | 0 | +: 1/1/1 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
254 | SSA_0686 | Fe2+/Zn2+ uptake regulation protein, putative | SSA_0687 | hypothetical protein | ->-> | 670140 | 670606 | 467 | 36.6% | 0 | 0 | 0 | +: 1/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
255 | SSA_0687 | hypothetical protein | SSA_0688 | 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase, putative | ->-> | 671351 | 671499 | 149 | 36.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
256 | SSA_0688 | 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase, putative | SSA_0689 | Penicillin-binding protein 2B, putative | ->-> | 672193 | 672401 | 209 | 36.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
257 | SSA_0689 | Penicillin-binding protein 2B, putative | SSA_0690 | Recombinational DNA repair protein (RecF pathway), putative | ->-> | 674469 | 674571 | 103 | 35.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
258 | SSA_0690 | Recombinational DNA repair protein (RecF pathway), putative | SSA_0691 | D-ala,D-ala ligase, putative | ->-> | 675169 | 675372 | 204 | 36.8% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
259 | SSA_0694 | Mutator protein, putative | SSA_0695 | hypothetical protein | ->-> | 678482 | 678588 | 107 | 31.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
260 | SSA_0696 | hypothetical protein | SSA_0697 | hypothetical protein | ->-> | 679981 | 680222 | 242 | 38.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
261 | SSA_0697 | hypothetical protein | SSA_0698 | Peptide chain release factor 3, putative | ->-> | 680337 | 680522 | 186 | 30.6% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
262 | SSA_0698 | Peptide chain release factor 3, putative | SSA_0699 | Methyltransferase, putative | ->-> | 682068 | 682355 | 288 | 33.3% | 0 | 0 | 0 | +: 0/3/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
263 | SSA_0700 | hypothetical protein | SSA_0701 | Cation transporter CorA family, putative | ->-> | 683401 | 684507 | 1107 | 35% | 0 | 0 | 1 | +: 0/3/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
264 | SSA_0701 | Cation transporter CorA family, putative | SSA_0702 | Aconitase A, putative | ->-> | 685417 | 685627 | 211 | 24.6% | 0 | 0 | 0 | +: 2/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
265 | SSA_0705 | hypothetical protein | SSA_0706 | RNA helicase, putative | <--> | 691041 | 691502 | 462 | 34.6% | 0 | 0 | 3 | +: 0/2/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
266 | SSA_0706 | RNA helicase, putative | SSA_0707 | Lactose phosphotransferase system transcriptional repressor, putative | ->-> | 692970 | 693354 | 385 | 33.2% | 0 | 0 | 0 | +: 1/1/1 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
267 | SSA_0707 | Lactose phosphotransferase system transcriptional repressor, putative | SSA_0708 | hypothetical protein | ->-> | 694102 | 694283 | 182 | 33.5% | 0 | 0 | 0 | +: 0/1/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
268 | SSA_0711 | hypothetical protein | SSA_0712 | P-type ATPase-metal cation transport (calcium efflux), putative | <-<- | 696722 | 696850 | 129 | 36.4% | 0 | 0 | 0 | +: 0/0/0 | -: 1/2/2 | 1 | 0 | 0 | 0 | Result | |
269 | SSA_0712 | P-type ATPase-metal cation transport (calcium efflux), putative | SSA_0713 | 1-acyl-sn-glycerol-3-phosphate acyltransferase, putative | <--> | 699191 | 699347 | 157 | 31.8% | 0 | 0 | 0 | +: 1/0/0 | -: 2/0/0 | 1 | 0 | 0 | 0 | Result | |
270 | SSA_0714 | hypothetical protein | SSA_0715 | DNA uptake protein, putative | ->-> | 700710 | 700865 | 156 | 28.2% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
271 | SSA_0716 | Competence protein, putative | SSA_0718 | Conserved uncharacterized protein | ->-> | 703771 | 703900 | 130 | 26.9% | 0 | 0 | 0 | +: 1/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
272 | SSA_0718 | Conserved uncharacterized protein | SSA_0720 | hypothetical protein | ->-> | 704996 | 705245 | 250 | 30.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
273 | SSA_0722 | hypothetical protein | SSA_0723 | hypothetical protein | ->-> | 708176 | 708385 | 210 | 28.1% | 0 | 0 | 0 | +: 1/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
274 | SSA_0723 | hypothetical protein | SSA_0724 | ABC-type multidrug/protein/lipid transport system (pediocin PA-1 exporter), ATPase and permease components, putative | ->-> | 708527 | 708791 | 265 | 31.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
275 | SSA_0725 | hypothetical protein | SSA_0726 | FmtA-like protein, putative | ->-> | 710873 | 711044 | 172 | 30.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
276 | SSA_0727 | Metal-dependent membrane protease, putative | SSA_0728 | Protease, putative | ->-> | 713700 | 713827 | 128 | 39.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
277 | SSA_0729 | hypothetical protein | SSA_0730 | Arsenical resistance operon transcription repressor (ArsR), putative | ->-> | 714738 | 714957 | 220 | 36.8% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
279 | SSA_0736 | Catabolite gene activator and regulatory subunit of cAMP-dependent protein kinases, putative | SSA_0737 | Arginine deiminase, putative | ->-> | 718475 | 718763 | 289 | 25.6% | 0 | 0 | 0 | +: 1/0/0 | -: 2/1/1 | 1 | 0 | 0 | 0 | Result | |
280 | SSA_0738 | Ornithine carbamoyltransferase, catabolic, putative | SSA_0739 | Carbamate kinase, putative | ->-> | 721061 | 721226 | 166 | 34.3% | 0 | 0 | 0 | +: 0/1/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
281 | SSA_0739 | Carbamate kinase, putative | SSA_0740 | C4-dicarboxylate anaerobic carrier, possible arginine transporter, putative | ->-> | 722175 | 722379 | 205 | 34.1% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
282 | SSA_0741 | Acetylornithine deacetylase/Succinyl-diaminopimelate desuccinylase, putative | SSA_0743 | Transcriptional repressor (arginine synthesis), putative | -><- | 725251 | 725378 | 128 | 35.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
283 | SSA_0746 | Glucosamine-6-phosphate deaminase, putative | SSA_0747 | DD-carboxypeptidase, putative | ->-> | 727926 | 728075 | 150 | 28.7% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
284 | SSA_0748 | Sugar:H+ symporter, permease of the major facilitator superfamily, putative | SSA_0749 | Competence protein, putative | ->-> | 730696 | 730807 | 112 | 33.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
285 | SSA_0749 | Competence protein, putative | SSA_0750 | hypothetical protein | ->-> | 731759 | 731928 | 170 | 28.8% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
286 | SSA_0750 | hypothetical protein | SSA_0751 | Oligoendopeptidase F, putative | ->-> | 732316 | 732506 | 191 | 29.3% | 0 | 0 | 0 | +: 0/1/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
287 | SSA_0752 | hypothetical protein | SSA_0753 | Foldase protein prsA precursor, putative | ->-> | 734995 | 735107 | 113 | 23% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
288 | SSA_0753 | Foldase protein prsA precursor, putative | SSA_0755 | hypothetical protein | ->-> | 736116 | 736351 | 236 | 40.3% | 0 | 0 | 0 | +: 1/1/0 | -: 0/0/0 | 1 | 4 | 26 | 194 | Result | tataataagactggtgagaattgatttttcaagttcttagttcagagaattggcggtgctgcgagccatctgagacggagaatcatgctactcatcttgaaaaatagaatacgaaatgagaatgacaagttcattgaatgaaggtggtaccgcggtttttcgcccttcg |
289 | SSA_0756 | Alanyl-tRNA synthetase, putative | SSA_0757 | N-acetyl-gamma-glutamyl-phosphate reductase, putative | ->-> | 739495 | 739735 | 241 | 30.3% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
290 | SSA_0760 | Acetylornithine aminotransferase, putative | SSA_0761 | Transcriptional regulator, XRE family, putative | ->-> | 743864 | 744016 | 153 | 25.5% | 0 | 0 | 0 | +: 1/2/0 | -: 2/0/0 | 1 | 0 | 0 | 0 | Result | |
291 | SSA_0766 | hypothetical protein | SSA_0767 | Diacylglycerol kinase catalytic domain protein, putative | ->-> | 747036 | 747226 | 191 | 35.1% | 0 | 0 | 0 | +: 1/1/1 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
292 | SSA_0767 | Diacylglycerol kinase catalytic domain protein, putative | SSA_0768 | Ribonucleoside-diphosphate reductase 2, beta subunit, putative | -><- | 748115 | 748225 | 111 | 35.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
293 | SSA_0770 | Ribonucleoside-diphosphate reductase, putative | SSA_0771 | Glutaredoxin-like protein, putative | <-<- | 751502 | 751661 | 160 | 38.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
294 | SSA_0771 | Glutaredoxin-like protein, putative | SSA_0772 | Histidine-containing phosphocarrier protein of the PTS, putative | <--> | 751881 | 752477 | 597 | 28.1% | 0 | 0 | 0 | +: 1/0/0 | -: 2/0/0 | 1 | 0 | 0 | 0 | Result | |
295 | SSA_0773 | PTS enzyme I, putative | SSA_0774 | NADP-dependent glyceraldehyde-3-phosphate dehydrogenase, putative | ->-> | 754477 | 754710 | 234 | 25.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
296 | SSA_0774 | NADP-dependent glyceraldehyde-3-phosphate dehydrogenase, putative | SSA_0775 | 1,4-alpha-glucan branching enzyme, putative | ->-> | 756136 | 756520 | 385 | 27.3% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
297 | SSA_0778 | Glycogen synthase, putative | SSA_0779 | Glycogen phosphorylase, putative | ->-> | 762137 | 762348 | 212 | 38.2% | 0 | 0 | 0 | +: 1/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
298 | SSA_0779 | Glycogen phosphorylase, putative | SSA_0780 | Acid phosphatase (PAP2 family), putative | ->-> | 764746 | 764887 | 142 | 38% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
299 | SSA_0780 | Acid phosphatase (PAP2 family), putative | SSA_0781 | Mannose-6-phosphate isomerase, putative | ->-> | 765389 | 765512 | 124 | 37.1% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
300 | SSA_0781 | Mannose-6-phosphate isomerase, putative | SSA_0782 | Proton-translocating ATPase, F0 sector, subunit c, putative | ->-> | 766455 | 766718 | 264 | 23.9% | 0 | 0 | 0 | +: 1/0/0 | -: 1/1/0 | 1 | 0 | 0 | 0 | Result | |
302 | SSA_0789 | Proton-translocating ATPase, F1 sector, epsilon subunit, putative | SSA_0790 | hypothetical protein | ->-> | 773014 | 773186 | 173 | 38.2% | 0 | 0 | 0 | +: 0/2/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
303 | SSA_0793 | DNA-entry nuclease, putative | SSA_0794 | Zn-dependent protease, putative | ->-> | 775860 | 776035 | 176 | 31.2% | 0 | 0 | 0 | +: 0/1/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
304 | SSA_0796 | ABC-NBD transporters with duplicated ATPase domains, putative | SSA_0797 | Transcriptional regulator, putative | ->-> | 779121 | 779660 | 540 | 36.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
305 | SSA_0801 | Mur ligase family protein, putative | SSA_0802 | hypothetical protein | <--> | 784208 | 784439 | 232 | 29.7% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
306 | SSA_0804 | Phosphoglucomutase/phosphomannomutase family protein, putative | SSA_0805 | Collagen-binding surface protein, putative | ->-> | 787488 | 787615 | 128 | 25% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
307 | SSA_0805 | Collagen-binding surface protein, putative | SSA_0806 | hypothetical protein | ->-> | 789293 | 789409 | 117 | 31.6% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
308 | SSA_0808 | hypothetical protein | SSA_0809 | Translation initiation inhibitor, yjgF family / endoribonuclease L-PSP, putative | ->-> | 791073 | 791285 | 213 | 31.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
309 | SSA_0813 | Thioredoxin reductase, putative | SSA_0814 | Oxidoreductase, pyridine nucleotide-disulfide, class I, putative | <-<- | 795497 | 795608 | 112 | 30.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
310 | SSA_0814 | Oxidoreductase, pyridine nucleotide-disulfide, class I, putative | SSA_0815 | hypothetical protein | <--> | 796926 | 797114 | 189 | 30.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
311 | SSA_0815 | hypothetical protein | SSA_0816 | Copper transport operon or penicillinase transcription repressor, putative | ->-> | 797472 | 797584 | 113 | 29.2% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
312 | SSA_0817 | Antirepressor regulating drug resistance (membrane-bound), putative | SSA_0818 | SPX domain-like protein, putative | ->-> | 799436 | 799814 | 379 | 33.2% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
313 | SSA_0819 | hypothetical protein | SSA_0820 | Ribosomal protein S21, putative | ->-> | 801242 | 801388 | 147 | 34% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
314 | SSA_0820 | Ribosomal protein S21, putative | SSA_0822 | Large conductance mechano-sensitive ion channel, putative | -><- | 801566 | 801678 | 113 | 36.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
315 | SSA_0822 | Large conductance mechano-sensitive ion channel, putative | SSA_0824 | DNA primase (bacterial type), putative | <--> | 802063 | 802192 | 130 | 21.5% | 0 | 0 | 0 | +: 2/0/0 | -: 2/0/0 | 1 | 0 | 0 | 0 | Result | |
316 | SSA_0825 | DNA-directed RNA polymerase, sigma subunit (sigma70/sigma32), putative | SSA_0826 | hypothetical protein | ->-> | 805117 | 805237 | 121 | 46.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
317 | SSA_0826 | hypothetical protein | SSA_0827 | Conserved uncharacterized cytosolic protein, putative | ->-> | 805577 | 806172 | 596 | 39.3% | 0 | 0 | 0 | +: 2/1/0 | -: 0/0/0 | 1 | 17 | 62 | 430 | Result | tataatgttcttattgtcttggggtcgttacggattcgacaggcattatgaggcacattttgcgactcatctagcggatgtaaaacgccagttaaatataactgcaaaaaataacaattcttacgctttagctgcctaaaaaccagccagcgtgacccgattcggattgcttgtgtctgatgacaggtcttattatgagcaagctacggcaaagtctagtctagggattttgcaagagattgatagactcgcttgacttgggcttgagctatgtgtcaaagtgaagttaaaccaatacatagcctatggttgtagacaaatgtgttagcaggtgtttggacgtgggttcgactcccaccggctccatta |
319 | SSA_0829 | Platelet-binding glycoprotein | SSA_0830 | Glycosyltransferase, putative | ->-> | 812226 | 812569 | 344 | 32.8% | 0 | 0 | 0 | +: 1/2/2 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
320 | SSA_0841 | hypothetical protein | SSA_0842 | Effector of murein hydrolase LrgA/holin-like protein, putative | ->-> | 827297 | 827469 | 173 | 34.1% | 0 | 0 | 0 | +: 0/3/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
321 | SSA_0848 | Pyruvate kinase I, fructose-stimulated, putative | SSA_0849 | Signal peptidase I, putative | ->-> | 836085 | 836266 | 182 | 33% | 0 | 0 | 0 | +: 1/0/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
322 | SSA_0849 | Signal peptidase I, putative | SSA_0850 | Ubiquitin C-terminal hydrolase, putative | ->-> | 836825 | 836957 | 133 | 33.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
323 | SSA_0851 | Cation efflux family protein, putative | SSA_0852 | ATP-dependent DNA helicase, putative | <--> | 838991 | 839189 | 199 | 35.2% | 0 | 0 | 0 | +: 1/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
324 | SSA_0857 | hypothetical protein | SSA_0858 | DTDP-L-rhamnose synthase, putative | ->-> | 845543 | 845651 | 109 | 27.5% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
325 | SSA_0858 | DTDP-L-rhamnose synthase, putative | SSA_0859 | Triosephosphate isomerase, putative | ->-> | 846507 | 846780 | 274 | 34.7% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
326 | SSA_0859 | Triosephosphate isomerase, putative | SSA_0860 | N-acetylmuramidase/lysin, putative | ->-> | 847546 | 847754 | 209 | 38.3% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
327 | SSA_0864 | hypothetical protein | SSA_0865 | hypothetical protein | <--> | 856409 | 856517 | 109 | 30.3% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
328 | SSA_0865 | hypothetical protein | SSA_0866 | Cation-transporting ATPase, E1-E 2 family, putative | ->-> | 856911 | 857122 | 212 | 34.4% | 0 | 0 | 0 | +: 0/1/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
329 | SSA_0868 | hypothetical protein | SSA_0869 | Peptide chain release factor 2, putative | <--> | 861626 | 862053 | 428 | 34.1% | 0 | 0 | 0 | +: 2/2/2 | -: 1/0/0 | 1 | 3 | 305 | 424 | Result | gtatttatggacatttcagaaattcgtcaaaagattgacgcaaatcgtgaaaaattagcttctttcagggggtctctttgacttagaaggtctggaagaagaaattgccatcttagaaaa |
330 | SSA_0872 | Zn-dependent hydrolases, including glyoxylases, putative | SSA_0873 | ATP-dependent DNA helicase; DNA polymerase III, epsilon subunit, putative | <--> | 865396 | 865530 | 135 | 32.6% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
331 | SSA_0876 | 4-methyl-5(B-hydroxyethyl)-thiazole monophosphate biosynthesis protein, putative | SSA_0877 | Phosphoglycolate phosphatase, putative | ->-> | 870922 | 871147 | 226 | 35.4% | 0 | 0 | 0 | +: 0/2/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
332 | SSA_0885 | hypothetical protein | SSA_0886 | Enolase, putative | <--> | 879605 | 879812 | 208 | 26.4% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
333 | SSA_0886 | Enolase, putative | SSA_0887 | hypothetical protein | -><- | 881118 | 881254 | 137 | 32.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
334 | SSA_0887 | hypothetical protein | SSA_0888 | Magnesium/cobalt transporter, putative | <--> | 881357 | 881468 | 112 | 33% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
335 | SSA_0891 | 3-carboxymuconate cyclase, putative | SSA_0892 | ATP-binding cassette lipoprotein, putative | <--> | 884124 | 884365 | 242 | 32.6% | 0 | 0 | 0 | +: 0/3/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
336 | SSA_0900 | Tetratricopeptide repeat (TPR) family protein | SSA_0901 | Alpha-acetolactate decarboxylase, putative | ->-> | 892438 | 892586 | 149 | 34.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
337 | SSA_0903 | NAD(P)H dehydrogenase (quinone), putative | SSA_0904 | CshA-like fibrillar surface protein A | ->-> | 893874 | 894045 | 172 | 31.4% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
338 | SSA_0904 | CshA-like fibrillar surface protein A | SSA_0905 | CshA-like fibrillar surface protein B | ->-> | 903019 | 903219 | 201 | 23.9% | 0 | 0 | 0 | +: 1/0/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
339 | SSA_0905 | CshA-like fibrillar surface protein B | SSA_0906 | CshA-like fibrillar surface protein C | ->-> | 909121 | 909461 | 341 | 22% | 0 | 0 | 0 | +: 1/2/2 | -: 1/1/0 | 1 | 0 | 0 | 0 | Result | |
340 | SSA_0906 | CshA-like fibrillar surface protein C | SSA_0907 | Fibronectin-binding protein A, putative | -><- | 917472 | 917657 | 186 | 36.6% | 0 | 0 | 0 | +: 0/2/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
341 | SSA_0907 | Fibronectin-binding protein A, putative | SSA_0908 | ABC-type uncharacterized transport system, periplasmic component, putative | <--> | 919308 | 919839 | 532 | 33.8% | 0 | 0 | 0 | +: 1/2/0 | -: 0/0/0 | 2 | 0 | 0 | 0 | Result | |
342 | SSA_0908 | ABC-type uncharacterized transport system, periplasmic component, putative | SSA_0909 | Transcriptional regulator, AbrB family (stationary/sporulation gene expression), putative | ->-> | 920848 | 921026 | 179 | 36.9% | 0 | 0 | 0 | +: 1/0/0 | -: 1/1/0 | 1 | 0 | 0 | 0 | Result | |
343 | SSA_0909 | Transcriptional regulator, AbrB family (stationary/sporulation gene expression), putative | SSA_0910 | ABC-type multidrug transporter, ATPase component, putative | ->-> | 921219 | 921495 | 277 | 28.9% | 0 | 0 | 0 | +: 1/1/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
344 | SSA_0911 | hypothetical protein | SSA_0912 | Phenylalanyl-tRNA synthetase alpha chain, putative | ->-> | 922959 | 923239 | 281 | 42.7% | 0 | 0 | 0 | +: 1/1/0 | -: 0/0/0 | 1 | 3 | 77 | 243 | Result | aatagcaatccgcaagaccagtaacctaggggaagtttaacagggaggggagccagcgactgaaagctctctagatgaaagctaggcgaattcacttgctatgggattgataagtaaggtctggcttgccagataaaaaacggatggtaccgcgtgtcaacgctccg |
345 | SSA_0913 | Acetyltransferase, putative | SSA_0914 | Phenylalanyl-tRNA synthetase beta chain, putative | ->-> | 924845 | 925091 | 247 | 35.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
346 | SSA_0914 | Phenylalanyl-tRNA synthetase beta chain, putative | SSA_0915 | hypothetical protein | ->-> | 927498 | 927681 | 184 | 37.5% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
347 | SSA_0915 | hypothetical protein | SSA_0916 | 2-hydroxy-6-oxo-6-phenylhexa-2,4-dienoate hydrolase, putative | ->-> | 928075 | 928224 | 150 | 38% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
348 | SSA_0916 | 2-hydroxy-6-oxo-6-phenylhexa-2,4-dienoate hydrolase, putative | SSA_0917 | Cobalamin-independent methionine synthase II, putative | -><- | 929053 | 929176 | 124 | 33.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
349 | SSA_0917 | Cobalamin-independent methionine synthase II, putative | SSA_0918 | Conserved uncharacterized protein | <--> | 930341 | 930537 | 197 | 31.5% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
350 | SSA_0922 | hypothetical protein | SSA_0923 | Transcriptional regulator, TetR/AcrR family, putative | <--> | 933041 | 933149 | 109 | 34.9% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
351 | SSA_0923 | Transcriptional regulator, TetR/AcrR family, putative | SSA_0924 | ABC-type antimicrobial peptide transport system, permease component, putative | ->-> | 933759 | 933877 | 119 | 37.8% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
352 | SSA_0926 | Histone acetyltransferase HPA2, putative | SSA_0927 | Transcriptional regulator, TetR/AcrR family, putative | ->-> | 936022 | 936188 | 167 | 31.1% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
353 | SSA_0931 | hypothetical protein | SSA_0932 | hypothetical protein | ->-> | 941396 | 941592 | 197 | 31.5% | 0 | 0 | 0 | +: 2/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
354 | SSA_0935 | tRNA pseudouridine synthase B, putative | SSA_0936 | FAD synthase, putative | ->-> | 945034 | 945278 | 245 | 33.9% | 0 | 0 | 0 | +: 2/2/2 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
355 | SSA_0936 | FAD synthase, putative | SSA_0937 | Arsenate reductase, glutaredoxin family, putative | ->-> | 946212 | 946322 | 111 | 24.3% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
356 | SSA_0940 | NOL1/NOP2/sun family protein, putative | SSA_0941 | ABC-type phosphate transport system, periplasmic component, putative | ->-> | 949071 | 949296 | 226 | 33.2% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
357 | SSA_0946 | Phosphate transport system regulatory protein, putative | SSA_0947 | hypothetical protein | ->-> | 954187 | 954342 | 156 | 29.5% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
358 | SSA_0947 | hypothetical protein | SSA_0948 | hypothetical protein | ->-> | 954937 | 955094 | 158 | 29.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 2 | 0 | 0 | 0 | Result | |
359 | SSA_0948 | hypothetical protein | SSA_0949 | hypothetical protein | ->-> | 955689 | 955846 | 158 | 25.9% | 0 | 0 | 0 | +: 1/0/0 | -: 1/0/0 | 2 | 0 | 0 | 0 | Result | |
360 | SSA_0954 | hypothetical protein | SSA_0955 | Aminopeptidase N, putative | ->-> | 958491 | 958658 | 168 | 36.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
361 | SSA_0955 | Aminopeptidase N, putative | SSA_0956 | surface protein D | ->-> | 961200 | 961362 | 163 | 27.6% | 0 | 0 | 0 | +: 1/1/1 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
362 | SSA_0956 | surface protein D | SSA_0957 | Dehydrogenase, putative | ->-> | 965479 | 966415 | 937 | 33.7% | 0 | 5 | 34 | +: 1/2/1 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
363 | SSA_0957 | Dehydrogenase, putative | SSA_0958 | hypothetical protein | ->-> | 967232 | 967412 | 181 | 29.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
364 | SSA_0958 | hypothetical protein | SSA_0959 | Two-component response transcriptional regulator (CheY-like receiver domain and a winged-helix DNA-binding domains), putative | ->-> | 967878 | 967981 | 104 | 26% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
365 | SSA_0961 | Possible ketopantoate reductase PanE/ApbA, putative | SSA_0962 | Lactoylglutathione lyase, putative | ->-> | 970992 | 971104 | 113 | 27.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
366 | SSA_0966 | Uridine kinase, putative | SSA_0967 | hypothetical protein | ->-> | 975851 | 976011 | 161 | 42.9% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
367 | SSA_0967 | hypothetical protein | SSA_0968 | hypothetical protein | ->-> | 976681 | 976838 | 158 | 31% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
368 | SSA_0968 | hypothetical protein | SSA_0969 | hypothetical protein | ->-> | 977202 | 977351 | 150 | 26% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 2 | 0 | 0 | 0 | Result | |
369 | SSA_0969 | hypothetical protein | SSA_0970 | hypothetical protein | ->-> | 977790 | 977929 | 140 | 25% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 2 | 0 | 0 | 0 | Result | |
370 | SSA_0973 | hypothetical protein | SSA_0975 | 2-isopropylmalate synthase, putative | ->-> | 980748 | 981110 | 363 | 34.4% | 0 | 0 | 0 | +: 1/4/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
371 | SSA_0983 | Conserved uncharacterized protein | SSA_0984 | SlyA-like protein, putative | ->-> | 987006 | 987193 | 188 | 30.3% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
372 | SSA_0987 | ABC-type choline transporter, membrane-spanning permease, putative | SSA_0988 | TfoX N-terminal domain family protein, putative | ->-> | 990655 | 990801 | 147 | 34.7% | 0 | 0 | 0 | +: 1/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
373 | SSA_0991 | Deoxyribonuclease, putative | SSA_0992 | hypothetical protein | <--> | 993433 | 993625 | 193 | 27.5% | 0 | 0 | 0 | +: 1/0/0 | -: 2/0/0 | 1 | 0 | 0 | 0 | Result | |
374 | SSA_0994 | Peptidase E, putative | SSA_0995 | Antibiotic-resistance protein, alpha/beta superfamily hydrolase, putative | ->-> | 995451 | 995855 | 405 | 33.8% | 0 | 0 | 6 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
375 | SSA_1005 | Sugar ABC transporter, permease protein, putative | SSA_1006 | Dextransucrase, putative | ->-> | 1007002 | 1007215 | 214 | 39.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
376 | SSA_1007 | ABC transporter ATP-binding protein-multiple sugar transport, putative | SSA_1008 | Galactokinase, putative | ->-> | 1009820 | 1009995 | 176 | 23.3% | 0 | 0 | 0 | +: 1/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
377 | SSA_1008 | Galactokinase, putative | SSA_1009 | Galactose-1-phosphate-uridylyltransferase, putative | ->-> | 1011175 | 1011393 | 219 | 44.3% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 2 | 1 | 79 | 191 | Result | ggttgagtgggctctattacgctgatttcatcagcttttacagccctaatcaactgtgcggaggtgggacgacgaaatcgaattctaacgaattaccgatttctgtcccactc |
378 | SSA_1010 | UDP-glucose 4-epimerase, putative | SSA_1011 | hypothetical protein | ->-> | 1013923 | 1014273 | 351 | 29.1% | 0 | 0 | 0 | +: 2/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
379 | SSA_1017 | hypothetical protein | SSA_1018 | Zinc metalloprotease zmpC precursor, putative | ->-> | 1023280 | 1023485 | 206 | 22.3% | 0 | 0 | 0 | +: 1/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
380 | SSA_1018 | Zinc metalloprotease zmpC precursor, putative | SSA_1019 | Collagen-binding surface protein, putative | ->-> | 1032630 | 1033016 | 387 | 26.4% | 0 | 0 | 0 | +: 0/3/0 | -: 1/3/0 | 1 | 0 | 0 | 0 | Result | |
381 | SSA_1019 | Collagen-binding surface protein, putative | SSA_1020 | hypothetical protein | ->-> | 1035438 | 1035696 | 259 | 28.6% | 0 | 0 | 0 | +: 1/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
382 | SSA_1020 | hypothetical protein | SSA_1021 | Conserved uncharacterized protein | ->-> | 1036165 | 1036283 | 119 | 34.5% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
383 | SSA_1024 | Alpha-amylase, putative | SSA_1026 | ABC-type multidrug transporter, ATPase component, putative | <--> | 1042739 | 1042933 | 195 | 30.8% | 0 | 0 | 0 | +: 0/0/0 | -: 1/2/0 | 1 | 0 | 0 | 0 | Result | |
384 | SSA_1028 | Transcriptional repressor, XRE family, putative | SSA_1029 | hypothetical protein | <-<- | 1046154 | 1046256 | 103 | 27.2% | 0 | 0 | 0 | +: 0/2/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
385 | SSA_1029 | hypothetical protein | SSA_1030 | Transcriptional regulator, TetR family, putative | <--> | 1047100 | 1047233 | 134 | 29.9% | 0 | 0 | 0 | +: 1/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
386 | SSA_1038 | Lipoprotein, putative | SSA_1039 | Sugar ABC transporter, ATP-binding protein, putative | ->-> | 1053775 | 1053913 | 139 | 36.7% | 0 | 0 | 0 | +: 0/1/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
387 | SSA_1041 | Sugar ABC transporter, permease protein, putative | SSA_1042 | Xylanase/chitin deacetylase, putative | -><- | 1057495 | 1057598 | 104 | 35.6% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
389 | SSA_1044 | Homoserine kinase, putative | SSA_1045 | hypothetical protein | ->-> | 1060860 | 1060980 | 121 | 34.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
390 | SSA_1045 | hypothetical protein | SSA_1047 | UDP-N-acetylenolpyruvoylglucosamine reductase, putative | ->-> | 1061893 | 1061999 | 107 | 25.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
391 | SSA_1047 | UDP-N-acetylenolpyruvoylglucosamine reductase, putative | SSA_1048 | ABC transporter ATP-binding protein-spermidine/putrescine transport, putative | ->-> | 1062906 | 1063086 | 181 | 44.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
392 | SSA_1052 | hypothetical protein | SSA_1053 | Pyruvate phosphate dikinase, putative | <-<- | 1067353 | 1067536 | 184 | 28.3% | 0 | 0 | 0 | +: 0/2/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
393 | SSA_1053 | Pyruvate phosphate dikinase, putative | SSA_1054 | CBS domain protein, putative | <--> | 1070159 | 1070403 | 245 | 24.5% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
394 | SSA_1056 | Firmicute fructose-1,6-bisphosphatase, putative | SSA_1057 | Aminotransferase, class-V, putative | ->-> | 1073811 | 1073910 | 100 | 32% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
395 | SSA_1060 | hypothetical protein | SSA_1061 | 50S ribosomal protein L21, putative | ->-> | 1077508 | 1077731 | 224 | 41.5% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 3 | 75 | 224 | Result | tgctatacttatagagttgactatgcacattcctgtgcaaccgcacgatcatcgttgctcactctgtgagatagaagtggttcgtcccacgatgctaggcgagtcttcacaaaatccggggaaaccccaaaaaatcataggaggtgcata |
397 | SSA_1062 | 50S ribosomal protein L27, putative | SSA_1063 | Peptidoglycan-binding domain-containing protein, putative | ->-> | 1078718 | 1078967 | 250 | 27.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
398 | SSA_1064 | hypothetical protein | SSA_1065 | Beta-hexosamidase A, putative | <--> | 1081156 | 1081397 | 242 | 24% | 0 | 0 | 0 | +: 2/0/0 | -: 2/0/0 | 1 | 0 | 0 | 0 | Result | |
399 | SSA_1065 | Beta-hexosamidase A, putative | SSA_1066 | ABC-type oligopeptide transport system, putative | ->-> | 1084191 | 1084474 | 284 | 33.5% | 0 | 0 | 0 | +: 2/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
400 | SSA_1066 | ABC-type oligopeptide transport system, putative | SSA_1067 | hypothetical protein | ->-> | 1086437 | 1086538 | 102 | 36.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
401 | SSA_1070 | Ribosomal large subunit pseudouridine synthase D, putative | SSA_1072 | Glutamate 5-kinase, putative | ->-> | 1089779 | 1089894 | 116 | 34.5% | 0 | 0 | 0 | +: 1/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
402 | SSA_1074 | Pyrroline-5-carboxylate reductase, putative | SSA_1075 | Coproporphyrinogen III oxidase, putative | ->-> | 1093095 | 1093232 | 138 | 28.3% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
403 | SSA_1079 | hypothetical protein | SSA_1080 | Transcriptional repressor of the fructose operon, DeoR family, putative | ->-> | 1097509 | 1097677 | 169 | 33.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
404 | SSA_1082 | PTS system, fructose specific II ABC components, putative | SSA_1083 | Conserved uncharacterized protein | ->-> | 1101312 | 1101437 | 126 | 34.9% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
405 | SSA_1087 | ABC-type transporter (antibiotic resistance protein), ATPase component, putative | SSA_1088 | hypothetical protein | ->-> | 1106533 | 1107187 | 655 | 32.7% | 0 | 0 | 0 | +: 0/3/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
406 | SSA_1090 | Glucokinase, putative | SSA_1091 | Thymidylate synthase, putative | ->-> | 1108671 | 1108774 | 104 | 35.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
407 | SSA_1091 | Thymidylate synthase, putative | SSA_1092 | Dihydrofolate reductase, putative | ->-> | 1109615 | 1109738 | 124 | 33.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
409 | SSA_1094 | GTP-binding protein, putative | SSA_1095 | Peptidoglycan hydrolase, putative | ->-> | 1112304 | 1112449 | 146 | 24.7% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
410 | SSA_1096 | Methyltransferase, putative | SSA_1098 | Formate-nitrate transporter, putative | ->-> | 1114160 | 1114273 | 114 | 21.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
411 | SSA_1098 | Formate-nitrate transporter, putative | SSA_1099 | Calcium binding hemolysin-like protein, putative | ->-> | 1115072 | 1115500 | 429 | 27.7% | 0 | 0 | 0 | +: 0/0/0 | -: 1/1/0 | 1 | 0 | 0 | 0 | Result | |
412 | SSA_1101 | Multidrug resistance efflux pump/hemolysin secretion transmembrane protein, putative | SSA_1102 | hypothetical protein | ->-> | 1123260 | 1123525 | 266 | 28.9% | 0 | 0 | 0 | +: 2/1/1 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
413 | SSA_1102 | hypothetical protein | SSA_1103 | hypothetical protein | ->-> | 1123868 | 1123972 | 105 | 33.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
415 | SSA_1105 | 50S ribosomal protein L7/ L12, putative | SSA_1106 | IgA-specific metalloendopeptidase | ->-> | 1125826 | 1126113 | 288 | 27.8% | 0 | 0 | 0 | +: 1/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
416 | SSA_1106 | IgA-specific metalloendopeptidase | SSA_1107 | Lipid/multidrug/protein-type ABC exporter, ATP binding/membrane-spanning protein, putative | ->-> | 1131739 | 1132107 | 369 | 35% | 0 | 0 | 0 | +: 1/4/2 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
417 | SSA_1110 | hypothetical protein | SSA_1111 | Branched-chain amino acid transport system II carrier protein, putative | ->-> | 1136246 | 1136671 | 426 | 25.8% | 0 | 0 | 0 | +: 1/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
418 | SSA_1111 | Branched-chain amino acid transport system II carrier protein, putative | SSA_1112 | Cell wall surface anchor family protein, putative | ->-> | 1138001 | 1138220 | 220 | 27.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
419 | SSA_1114 | Histidine kinase, putative | SSA_1115 | Cytochrome C-type biogenesis protein, putative | ->-> | 1141612 | 1141753 | 142 | 26.1% | 0 | 0 | 0 | +: 0/1/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
420 | SSA_1120 | Two-component sensor kinase (with C-terminal ATPase domain), putative | SSA_1121 | Cytochrome C-type biogenesis protein, putative | ->-> | 1147066 | 1147288 | 223 | 30.9% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
421 | SSA_1125 | NADPH-dependent FMN reductase, putative | SSA_1126 | Thiamine biosynthesis lipoprotein, putative | <-<- | 1150505 | 1150676 | 172 | 33.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
422 | SSA_1126 | Thiamine biosynthesis lipoprotein, putative | SSA_1127 | H2O-forming NADH dehydrogenase, putative | <--> | 1151613 | 1151870 | 258 | 30.2% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
423 | SSA_1127 | H2O-forming NADH dehydrogenase, putative | SSA_1128 | Voltage gated chloride channel EriC, putative | ->-> | 1153248 | 1153389 | 142 | 31% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
424 | SSA_1128 | Voltage gated chloride channel EriC, putative | SSA_1129 | Periplasmic iron transport lipoprotein, putative | ->-> | 1154947 | 1155064 | 118 | 28.8% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
426 | SSA_1134 | Xanthine phosphoribosyltransferase, putative | SSA_1135 | Na+-driven multidrug efflux pump, putative | ->-> | 1160377 | 1160491 | 115 | 30.4% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
427 | SSA_1135 | Na+-driven multidrug efflux pump, putative | SSA_1136 | ATPases with chaperone activity, ATP-binding subunit, putative | ->-> | 1161836 | 1162063 | 228 | 25.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
428 | SSA_1136 | ATPases with chaperone activity, ATP-binding subunit, putative | SSA_1137 | Dihydrolipoamide dehydrogenase, putative | ->-> | 1164308 | 1164514 | 207 | 33.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
429 | SSA_1140 | Dihydrolipoamide acetyl transferase, E2 component, putative | SSA_1143 | Na+-driven multidrug efflux pump, putative | -><- | 1169268 | 1172237 | 2970 | 36.7% | 0 | 0 | 69 | +: 3/7/3 | -: 0/6/0 | 1 | 0 | 0 | 0 | Result | |
430 | SSA_1143 | Na+-driven multidrug efflux pump, putative | SSA_1144 | Beta-N-acetylhexosaminidase, putative | <-<- | 1173588 | 1173738 | 151 | 36.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
431 | SSA_1145 | hypothetical protein | SSA_1146 | Phosphotransferase system cellobiose-specific component IIA, putative | <--> | 1176222 | 1176592 | 371 | 30.2% | 0 | 0 | 0 | +: 1/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
432 | SSA_1150 | Tautomerase, putative | SSA_1151 | Thymidine kinase, putative | <--> | 1180167 | 1180289 | 123 | 22% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
433 | SSA_1157 | PvaA-like protein, putative | SSA_1158 | hypothetical protein | ->-> | 1186279 | 1186392 | 114 | 26.3% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
434 | SSA_1158 | hypothetical protein | SSA_1161 | hypothetical protein | ->-> | 1187248 | 1187522 | 275 | 36.7% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
435 | SSA_1163 | GMP synthase [glutamine-hydrolyzing], putative | SSA_1164 | hypothetical protein | <-<- | 1190989 | 1191096 | 108 | 32.4% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
436 | SSA_1165 | Transcriptional regulator, GntR family, putative | SSA_1166 | hypothetical protein | ->-> | 1191926 | 1192068 | 143 | 31.5% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
437 | SSA_1166 | hypothetical protein | SSA_1167 | SRP54, signal recognition particle GTPase protein, putative | ->-> | 1192411 | 1192656 | 246 | 39.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
438 | SSA_1168 | hypothetical protein | SSA_1169 | Conserved hypothetical protein with an alpha/beta hydrolase fold, putative | ->-> | 1195983 | 1196090 | 108 | 25.9% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
439 | SSA_1169 | Conserved hypothetical protein with an alpha/beta hydrolase fold, putative | SSA_1170 | hypothetical protein | -><- | 1196907 | 1197022 | 116 | 25% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
440 | SSA_1170 | hypothetical protein | SSA_1171 | Tyrosine recombinase xerC | <--> | 1198052 | 1198227 | 176 | 20.5% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
441 | SSA_1172 | hypothetical protein | SSA_1173 | Lipoate protein ligase A, putative | <-<- | 1200017 | 1200181 | 165 | 33.3% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
442 | SSA_1175 | Acetoin dehydrogenase complex, E2 component, dihydrolipoamide acetyltransferase, putative | SSA_1176 | Acetoin dehydrogenase, E1 component, beta subunit, putative | <-<- | 1204067 | 1204526 | 460 | 32.6% | 0 | 0 | 0 | +: 1/3/3 | -: 1/7/0 | 1 | 1 | 129 | 236 | Result | catgatactaaggcgttaaaaatcaaagtgaaaatagaaaacttaacgaagaaattttcgtttctagaaaagtttatctttttcacacagactttagcccatgttcaa |
443 | SSA_1178 | Acetoin dehydrogenase, E1 component, alpha subunit, putative | SSA_1179 | Carbamoylphosphate synthase large subunit / biotin carboxylase, putative | <-<- | 1206508 | 1206729 | 222 | 29.7% | 0 | 0 | 0 | +: 0/1/0 | -: 1/1/1 | 1 | 0 | 0 | 0 | Result | |
444 | SSA_1181 | Hydrolase, alpha/beta superfamily, putative | SSA_1182 | Gid-like protein, putative | <-<- | 1209507 | 1209621 | 115 | 17.4% | 0 | 0 | 0 | +: 1/2/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
445 | SSA_1182 | Gid-like protein, putative | SSA_1183 | hypothetical protein | <-<- | 1210957 | 1211057 | 101 | 34.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
447 | SSA_1189 | GTP-binding protein, putative | SSA_1190 | Conserved uncharacterized protein | <-<- | 1217748 | 1217888 | 141 | 31.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
448 | SSA_1191 | hypothetical protein | SSA_1192 | hypothetical protein | <-<- | 1218414 | 1218524 | 111 | 31.5% | 0 | 0 | 0 | +: 1/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
449 | SSA_1194 | Aspartate-semialdehyde dehydrogenase, putative | SSA_1196 | Acetyltransferase, GNAT family, putative | <-<- | 1221280 | 1221617 | 338 | 37% | 0 | 0 | 0 | +: 1/0/0 | -: 1/1/1 | 1 | 0 | 0 | 0 | Result | |
450 | SSA_1200 | Formate--tetrahydrofolate ligase, putative | SSA_1201 | hypothetical protein | <--> | 1225682 | 1225894 | 213 | 27.2% | 0 | 0 | 0 | +: 1/1/1 | -: 3/1/0 | 1 | 0 | 0 | 0 | Result | |
451 | SSA_1203 | hypothetical protein | SSA_1204 | Phosphoglucomutase | ->-> | 1227689 | 1227926 | 238 | 31.5% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
452 | SSA_1204 | Phosphoglucomutase | SSA_1205 | Bta, putative | ->-> | 1229646 | 1229769 | 124 | 30.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
453 | SSA_1211 | hypothetical protein | SSA_1212 | Ribose-phosphate pyrophosphokinase 2, putative | ->-> | 1235405 | 1235540 | 136 | 30.1% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
454 | SSA_1214 | Conserved uncharacterized Lactobacillales protein | SSA_1215 | hypothetical protein | ->-> | 1237970 | 1238085 | 116 | 35.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
455 | SSA_1215 | hypothetical protein | SSA_1216 | AT-rich DNA-binding protein, possible redox-sensing transcriptional repressor, putative | ->-> | 1238308 | 1238431 | 124 | 29% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
456 | SSA_1218 | DNA repair protein radC, putative | SSA_1219 | Sortase, putative | <-<- | 1240550 | 1240671 | 122 | 30.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
457 | SSA_1220 | DNA gyrase A subunit, putative | SSA_1221 | L-lactate dehydrogenase, putative | <--> | 1243923 | 1244095 | 173 | 30.1% | 0 | 0 | 0 | +: 1/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
459 | SSA_1224 | hypothetical protein | SSA_1225 | Branched-chain amino acid aminotransferase, putative | <-<- | 1247572 | 1247678 | 107 | 36.4% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
460 | SSA_1225 | Branched-chain amino acid aminotransferase, putative | SSA_1226 | ParC, putative | <-<- | 1248699 | 1248872 | 174 | 30.5% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
461 | SSA_1226 | ParC, putative | SSA_1227 | Aminoglycoside adenylyltransferase, putative | <-<- | 1251324 | 1251568 | 245 | 30.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 7 | 5 | 231 | Result | gatacagagcccgtaaaatacaaagtgaaaataggaaattcttacagtgagcgatgctcacaagagaatttatctttttcacacagtatttagggcgtgttcaactcctttcaaagaatgtagagtagttttttataaaataaaggatattttacgaaaattagtcccgtgttcaattactataagtaaccaaactatcctttctgtagttttaatgttttaaatta |
463 | SSA_1230 | Conserved uncharacterized protein | SSA_1231 | hypothetical protein | <-<- | 1253449 | 1253738 | 290 | 33.4% | 0 | 0 | 0 | +: 0/1/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
464 | SSA_1232 | Topoisomerase IV subunit B, putative | SSA_1233 | Membrane protein, YqiH family, putative | <--> | 1256846 | 1257035 | 190 | 30.5% | 0 | 0 | 0 | +: 1/1/1 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
465 | SSA_1234 | 5'-nucleotidase, putative | SSA_1235 | Dihydroorotase, putative | <-<- | 1259886 | 1260048 | 163 | 27% | 0 | 0 | 0 | +: 0/2/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
466 | SSA_1239 | hypothetical protein | SSA_1240 | Orotate phosphoribosyltransferase, putative | <-<- | 1264780 | 1264890 | 111 | 34.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
467 | SSA_1241 | Orotidine-5'-phosphate decarboxylase, putative | SSA_1242 | Dihydroorotate dehydrogenase B, putative | <-<- | 1266292 | 1266537 | 246 | 37.4% | 0 | 0 | 0 | +: 0/0/0 | -: 1/2/0 | 1 | 0 | 0 | 0 | Result | |
468 | SSA_1243 | Dihydroorotate dehydrogenase electron transfer subunit, putative | SSA_1244 | hypothetical protein | <-<- | 1268295 | 1268554 | 260 | 41.2% | 0 | 0 | 0 | +: 0/0/0 | -: 1/1/0 | 1 | 0 | 0 | 0 | Result | |
469 | SSA_1245 | Transcriptional regulator, LysR family, putative | SSA_1246 | hypothetical protein | -><- | 1269771 | 1269887 | 117 | 41.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
470 | SSA_1252 | hypothetical protein | SSA_1253 | hypothetical protein | <-<- | 1277596 | 1281065 | 3470 | 44.8% | 0 | 0 | 0 | +: 0/1/0 | -: 2/7/5 | 1 | 0 | 0 | 0 | Result | |
471 | SSA_1255 | hypothetical protein | SSA_1256 | NAD-dependent deacetylase, putative | <-<- | 1282335 | 1282446 | 112 | 20.5% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
472 | SSA_1258 | Purine nucleoside phosphorylase, family 1, putative | SSA_1259 | Purine nucleoside phosphorylase, putative | <-<- | 1284743 | 1284999 | 257 | 36.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
473 | SSA_1261 | Ribose-5-phosphate isomerase A, putative | SSA_1262 | tRNA modification GTPase, possibly iron-binding, putative | <--> | 1287745 | 1287921 | 177 | 32.8% | 0 | 0 | 0 | +: 1/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
474 | SSA_1268 | Chorismate mutase/prephenate dehydratase, putative | SSA_1269 | hypothetical protein | <-<- | 1291701 | 1292059 | 359 | 39.8% | 0 | 0 | 0 | +: 0/2/0 | -: 2/6/10 | 1 | 0 | 0 | 0 | Result | |
475 | SSA_1269 | hypothetical protein | SSA_1270 | Flavodoxin | <-<- | 1293443 | 1293565 | 123 | 39% | 0 | 0 | 0 | +: 0/1/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
476 | SSA_1270 | Flavodoxin | SSA_1271 | Conserved uncharacterized protein | <--> | 1294007 | 1294111 | 105 | 26.7% | 0 | 0 | 0 | +: 1/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
477 | SSA_1271 | Conserved uncharacterized protein | SSA_1272 | 50S ribosomal protein L31 type B, putative | ->-> | 1295048 | 1295154 | 107 | 30.8% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
478 | SSA_1272 | 50S ribosomal protein L31 type B, putative | SSA_1274 | hypothetical protein | -><- | 1295398 | 1295606 | 209 | 31.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
479 | SSA_1275 | hypothetical protein | SSA_1276 | Conserved uncharacterized protein | <-<- | 1297697 | 1298245 | 549 | 23.5% | 0 | 0 | 0 | +: 0/3/0 | -: 2/0/0 | 1 | 0 | 0 | 0 | Result | |
480 | SSA_1277 | D-alanyl-D-alanine carboxypeptidase | SSA_1278 | Rhodanese-like domain protein, putative | <-<- | 1299307 | 1299652 | 346 | 33.2% | 0 | 0 | 0 | +: 0/0/0 | -: 1/2/0 | 1 | 0 | 0 | 0 | Result | |
481 | SSA_1279 | Oxidoreductase, putative | SSA_1280 | hypothetical protein | <-<- | 1300923 | 1301197 | 275 | 42.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
482 | SSA_1283 | Nitroreductase, putative | SSA_1284 | hypothetical protein | <-<- | 1304427 | 1304535 | 109 | 28.4% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
483 | SSA_1285 | hypothetical protein | SSA_1286 | hypothetical protein | <-<- | 1305560 | 1305848 | 289 | 26.6% | 0 | 0 | 0 | +: 0/1/0 | -: 1/1/1 | 2 | 0 | 0 | 0 | Result | |
484 | SSA_1287 | hypothetical protein | SSA_1288 | hypothetical protein | <-<- | 1306828 | 1307185 | 358 | 28.8% | 0 | 0 | 0 | +: 0/1/0 | -: 1/2/2 | 2 | 0 | 0 | 0 | Result | |
486 | SSA_1289 | hypothetical protein | SSA_1291 | hypothetical protein | <-<- | 1308476 | 1309080 | 605 | 28.8% | 0 | 0 | 2 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
487 | SSA_1296 | hypothetical protein | SSA_1297 | Nuclease subunit of the excinuclease complex, subunit C, putative | <-<- | 1313104 | 1313230 | 127 | 26% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
488 | SSA_1297 | Nuclease subunit of the excinuclease complex, subunit C, putative | SSA_1298 | Maltose/maltodextrin ABC transporter, sugar-binding protein MalX, putative | <--> | 1315067 | 1315430 | 364 | 26.6% | 0 | 0 | 0 | +: 1/1/1 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
489 | SSA_1300 | Maltose ABC transporter, permease protein, putative | SSA_1301 | Conserved uncharacterized protein, possible surface protein | -><- | 1318964 | 1319099 | 136 | 24.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
490 | SSA_1301 | Conserved uncharacterized protein, possible surface protein | SSA_1302 | tRNA (Guanine-N(1)-)-methyltransferase, putative | <-<- | 1321662 | 1321851 | 190 | 25.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
491 | SSA_1305 | hypothetical protein | SSA_1306 | Trk transporter NAD+ binding protein-K+ transport, putative | <-<- | 1324170 | 1324334 | 165 | 35.2% | 0 | 0 | 0 | +: 0/0/0 | -: 1/1/0 | 1 | 0 | 0 | 0 | Result | |
492 | SSA_1308 | hypothetical protein | SSA_1309 | RNA-binding protein (KH domain), putative | <-<- | 1326909 | 1327168 | 260 | 42.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
493 | SSA_1310 | 30S ribosomal protein S16, putative | SSA_1311 | Hydrolase, haloacid dehalogenase-like family, putative | <-<- | 1327701 | 1327931 | 231 | 28.1% | 0 | 0 | 0 | +: 0/1/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
494 | SSA_1311 | Hydrolase, haloacid dehalogenase-like family, putative | SSA_1312 | RADC-like protein, putative | <-<- | 1328484 | 1328826 | 343 | 37.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
495 | SSA_1313 | hypothetical protein | SSA_1314 | Fe-S-cluster oxidoreductase, putative | <-<- | 1330639 | 1330835 | 197 | 38.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
496 | SSA_1314 | Fe-S-cluster oxidoreductase, putative | SSA_1315 | hypothetical protein | <-<- | 1331331 | 1331497 | 167 | 30.5% | 0 | 0 | 0 | +: 1/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
497 | SSA_1315 | hypothetical protein | SSA_1316 | Nicotinamide mononucleotide transporter, putative | <-<- | 1332143 | 1332246 | 104 | 29.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
498 | SSA_1316 | Nicotinamide mononucleotide transporter, putative | SSA_1317 | hypothetical protein | <-<- | 1333039 | 1333487 | 449 | 29.8% | 0 | 0 | 0 | +: 0/1/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
499 | SSA_1317 | hypothetical protein | SSA_1318 | GTP-binding protein lepA, putative | <-<- | 1333635 | 1334078 | 444 | 34.5% | 0 | 0 | 0 | +: 0/1/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
500 | SSA_1318 | GTP-binding protein lepA, putative | SSA_1319 | hypothetical protein | <--> | 1335912 | 1336024 | 113 | 30.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
501 | SSA_1321 | Ferrochelatase, putative | SSA_1322 | Glycosyl transferase, putative | <-<- | 1338434 | 1338625 | 192 | 30.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
502 | SSA_1325 | Ketoacyl reductase hetN, putative | SSA_1326 | Peptidase T, putative | <--> | 1342434 | 1342571 | 138 | 29% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
503 | SSA_1328 | hypothetical protein | SSA_1329 | Conserved uncharacterized protein | <-<- | 1344987 | 1345115 | 129 | 29.5% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
504 | SSA_1330 | hypothetical protein | SSA_1331 | Conserved uncharacterized protein | <-<- | 1346459 | 1346562 | 104 | 35.6% | 0 | 0 | 0 | +: 0/0/0 | -: 2/0/0 | 1 | 0 | 0 | 0 | Result | |
505 | SSA_1336 | Conserved ankyrin repeat protein, putative | SSA_1337 | hypothetical protein | <-<- | 1350217 | 1350581 | 365 | 28.8% | 0 | 0 | 1 | +: 0/0/0 | -: 1/1/0 | 1 | 0 | 0 | 0 | Result | |
507 | SSA_1338 | hypothetical protein | SSA_1339 | Pneumococcal histidine triad protein D precursor, putative | <-<- | 1351818 | 1351968 | 151 | 29.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
508 | SSA_1340 | Zn/Mn ABC-type porter lipoprotein, putative | SSA_1341 | Carbamoyl-phosphate synthase large chain, putative | <-<- | 1356463 | 1356737 | 275 | 30.5% | 0 | 0 | 0 | +: 0/1/0 | -: 1/2/1 | 1 | 0 | 0 | 0 | Result | |
509 | SSA_1343 | Aspartate carbamoyltransferase, putative | SSA_1344 | Xanthine/uracil permeases, putative | <-<- | 1362050 | 1362158 | 109 | 40.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
510 | SSA_1345 | Bifunctional pyrimidine operon transcriptional attenuation protein/uracil phosphoribosyltransferase, putative | SSA_1346 | hypothetical protein | <-<- | 1363970 | 1364240 | 271 | 31% | 0 | 0 | 0 | +: 0/1/0 | -: 1/2/0 | 1 | 0 | 0 | 0 | Result | |
511 | SSA_1347 | PhnA protein, putative | SSA_1348 | hypothetical protein | <--> | 1365232 | 1365494 | 263 | 33.5% | 0 | 0 | 0 | +: 1/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
512 | SSA_1349 | Transcriptional regulator, biotin repressor family, putative | SSA_1350 | hypothetical protein | -><- | 1366574 | 1367034 | 461 | 31.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
513 | SSA_1356 | Helicase subunit of the DNA excision repair complex, subunit B, putative | SSA_1357 | hypothetical protein | <-<- | 1372006 | 1372166 | 161 | 37.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
514 | SSA_1358 | hypothetical protein | SSA_1359 | Arginine/histidine ABC transporter, permease component, putative | <--> | 1374127 | 1374321 | 195 | 32.3% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
517 | SSA_1371 | FmtA-like protein, putative | SSA_1372 | hypothetical protein | <-<- | 1388923 | 1389035 | 113 | 31% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
518 | SSA_1372 | hypothetical protein | SSA_1373 | ATPase components of ABC transporters with duplicated ATPase domains, multidrug transport system, putative | <--> | 1389228 | 1389846 | 619 | 30% | 0 | 0 | 0 | +: 3/3/0 | -: 1/2/1 | 1 | 0 | 0 | 0 | Result | |
519 | SSA_1376 | Transport protein, putative | SSA_1377 | Asparaginyl-tRNA synthetase, putative | <-<- | 1396202 | 1396357 | 156 | 32.7% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
520 | SSA_1378 | hypothetical protein | SSA_1379 | hypothetical protein | <-<- | 1398089 | 1398267 | 179 | 36.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
521 | SSA_1381 | hypothetical protein | SSA_1382 | hypothetical protein | <-<- | 1399656 | 1399886 | 231 | 35.1% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
522 | SSA_1382 | hypothetical protein | SSA_1383 | Aspartate aminotransferase, putative | <-<- | 1400361 | 1400626 | 266 | 35.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
523 | SSA_1384 | hypothetical protein | SSA_1385 | Multiple antibiotic resistance operon transcription repressor (MarR), putative | <--> | 1402294 | 1402407 | 114 | 24.6% | 0 | 0 | 0 | +: 1/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
524 | SSA_1389 | hypothetical protein | SSA_1390 | hypothetical protein | <-<- | 1405003 | 1405722 | 720 | 29.4% | 0 | 0 | 0 | +: 1/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
525 | SSA_1396 | hypothetical protein | SSA_1397 | hypothetical protein | <--> | 1410465 | 1410728 | 264 | 36.4% | 0 | 0 | 2 | +: 2/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
526 | SSA_1408 | hypothetical protein | SSA_1409 | DTDP-glucose-4,6-dehydratase, putative | <-<- | 1421096 | 1421298 | 203 | 34.5% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
527 | SSA_1409 | DTDP-glucose-4,6-dehydratase, putative | SSA_1410 | DTDP-4-keto-6-deoxyglucose-3,5-epimerase, putative | <-<- | 1422346 | 1422582 | 237 | 33.8% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
528 | SSA_1417 | SAM-dependent methyltransferase, putative | SSA_1418 | Conserved uncharacterized protein | <-<- | 1428084 | 1428228 | 145 | 37.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
529 | SSA_1420 | Homoserine O-succinyltransferase, putative | SSA_1421 | Adenine phosphoribosyltransferase, putative | <-<- | 1430716 | 1430862 | 147 | 28.6% | 0 | 0 | 0 | +: 0/0/0 | -: 1/1/0 | 1 | 0 | 0 | 0 | Result | |
530 | SSA_1423 | Single-stranded DNA-specific exonuclease, 5'-3', putative | SSA_1424 | Hydrolase, putative | <-<- | 1433874 | 1433978 | 105 | 38.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
531 | SSA_1424 | Hydrolase, putative | SSA_1428 | hypothetical protein | <-<- | 1434570 | 1435727 | 1158 | 42.4% | 0 | 0 | 10 | +: 0/0/0 | -: 1/1/0 | 1 | 0 | 0 | 0 | Result | |
532 | SSA_1434 | Conserved uncharacterized Firmicutes protein | SSA_1435 | hypothetical protein | -><- | 1441161 | 1441840 | 680 | 37.9% | 0 | 0 | 0 | +: 2/0/0 | -: 1/2/0 | 1 | 0 | 0 | 0 | Result | |
533 | SSA_1440 | Phosphoribosyl-ATP pyrophosphohydrolase, putative | SSA_1441 | Phosphoribosyl-AMP cyclohydrolase, putative | <-<- | 1444812 | 1444928 | 117 | 31.6% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
534 | SSA_1449 | Histidinol-phosphate/aromatic aminotransferase and cobyric acid decarboxylase, putative | SSA_1450 | hypothetical protein | <-<- | 1452022 | 1452494 | 473 | 38.9% | 0 | 0 | 0 | +: 0/0/0 | -: 1/1/0 | 1 | 0 | 0 | 0 | Result | |
535 | SSA_1452 | Second subunit of major exonuclease, putative | SSA_1453 | hypothetical protein | <-<- | 1459787 | 1459986 | 200 | 39.5% | 0 | 0 | 0 | +: 0/0/0 | -: 1/1/0 | 1 | 0 | 0 | 0 | Result | |
536 | SSA_1456 | hypothetical protein | SSA_1457 | Neopullulanase, putative | <-<- | 1462440 | 1462574 | 135 | 28.9% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
537 | SSA_1457 | Neopullulanase, putative | SSA_1458 | hypothetical protein | <-<- | 1464330 | 1464558 | 229 | 29.3% | 0 | 0 | 0 | +: 0/0/0 | -: 1/1/1 | 1 | 0 | 0 | 0 | Result | |
538 | SSA_1458 | hypothetical protein | SSA_2384 | Acetyltransferase, GNAT family, putative | <-<- | 1465438 | 1465557 | 120 | 30.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
539 | SSA_2384 | Acetyltransferase, GNAT family, putative | SSA_1459 | RNA methyltransferase, putative | <-<- | 1465987 | 1466200 | 214 | 45.3% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
540 | SSA_1464 | 3-phosphoshikimate 1-carboxyvinyltransferase, putative | SSA_1465 | Conserved uncharacterized protein | <-<- | 1471607 | 1471737 | 131 | 33.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
541 | SSA_1471 | hypothetical protein | SSA_1472 | hypothetical protein | <-<- | 1478235 | 1478574 | 340 | 29.7% | 0 | 0 | 0 | +: 0/0/0 | -: 1/2/2 | 1 | 0 | 0 | 0 | Result | |
542 | SSA_1473 | hypothetical protein | SSA_1474 | Lipoprotein, putative | <-<- | 1479011 | 1479156 | 146 | 34.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
543 | SSA_1474 | Lipoprotein, putative | SSA_1475 | hypothetical protein | <-<- | 1479832 | 1480064 | 233 | 28.3% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
544 | SSA_1475 | hypothetical protein | SSA_1476 | Phosphoglycerol transferase, alkaline phosphatase superfamily, putative | <--> | 1480212 | 1480312 | 101 | 31.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
548 | SSA_1481 | FmtA-like protein, putative | SSA_1482 | Pullulanase, putative | <-<- | 1486713 | 1487038 | 326 | 39.9% | 0 | 60 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
549 | SSA_1484 | DNA ligase, putative | SSA_1485 | Citrulline cluster-linked gene, putative | <-<- | 1492279 | 1492383 | 105 | 34.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
550 | SSA_1485 | Citrulline cluster-linked gene, putative | SSA_1486 | hypothetical protein | <--> | 1492900 | 1493061 | 162 | 42.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
552 | SSA_1494 | Conserved uncharacterized protein | SSA_1495 | S-adenosylmethionine synthetase, putative | <-<- | 1500864 | 1501108 | 245 | 32.2% | 0 | 0 | 0 | +: 1/0/0 | -: 1/1/1 | 1 | 0 | 0 | 0 | Result | |
553 | SSA_1495 | S-adenosylmethionine synthetase, putative | SSA_1496 | hypothetical protein | <-<- | 1502300 | 1502562 | 263 | 29.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
554 | SSA_1496 | hypothetical protein | SSA_1497 | DCMP deaminase, putative | <-<- | 1502995 | 1503157 | 163 | 33.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
555 | SSA_1497 | DCMP deaminase, putative | SSA_1498 | 50S ribosomal protein L20, putative | <-<- | 1503626 | 1503842 | 217 | 29% | 0 | 0 | 0 | +: 1/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
556 | SSA_1500 | Translation initiation factor IF-3, putative | SSA_1501 | Cytidylate kinase, putative | <-<- | 1505012 | 1505184 | 173 | 40.5% | 0 | 0 | 0 | +: 0/0/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
557 | SSA_1510 | Rhamnosyltransferase, putative | SSA_1511 | Glycosyltransferase, putative | <-<- | 1515427 | 1515539 | 113 | 36.3% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
558 | SSA_1519 | Polysaccharide/teichoic acid transporter, putative | SSA_1520 | Elongation factor Tu, putative | <-<- | 1526160 | 1526474 | 315 | 34% | 0 | 0 | 0 | +: 0/2/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
559 | SSA_1520 | Elongation factor Tu, putative | SSA_1521 | Phosphoenolpyruvate carboxylase, putative | <-<- | 1527672 | 1527926 | 255 | 28.2% | 0 | 0 | 0 | +: 0/0/0 | -: 1/2/0 | 1 | 5 | 7 | 107 | Result | aaaagcctccaataaaatatattttatagatagacagtaggcaatacagtctaactttccttactattttatcaaatttaaatgaaaatgcaagtctttta |
560 | SSA_1522 | Cell division protein FtsW, putative | SSA_1523 | Glutathione peroxidase, putative | <--> | 1532053 | 1532206 | 154 | 31.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
561 | SSA_1523 | Glutathione peroxidase, putative | SSA_1525 | Lyzozyme M1 (1,4-beta-N-acetylmuramidase), putative | ->-> | 1532681 | 1532885 | 205 | 27.8% | 0 | 0 | 0 | +: 2/1/1 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
562 | SSA_1525 | Lyzozyme M1 (1,4-beta-N-acetylmuramidase), putative | SSA_1526 | hypothetical protein | ->-> | 1533744 | 1533861 | 118 | 31.4% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
563 | SSA_1528 | Phosphoglycerate mutase, putative | SSA_1529 | Lysyl-tRNA synthetase, putative | ->-> | 1535911 | 1536010 | 100 | 30% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
564 | SSA_1533 | Glutathione reductase, putative | SSA_1535 | hypothetical protein | -><- | 1542273 | 1542546 | 274 | 28.1% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
565 | SSA_1535 | hypothetical protein | SSA_1536 | Biotin synthase, putative | <--> | 1543279 | 1543748 | 470 | 32.3% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
566 | SSA_1541 | Peptidase, U32 family, putative | SSA_1542 | Peptidase, U32 family, putative | <-<- | 1546691 | 1546914 | 224 | 23.2% | 0 | 0 | 0 | +: 1/0/0 | -: 1/1/1 | 1 | 0 | 0 | 0 | Result | |
567 | SSA_1543 | hypothetical protein | SSA_1544 | Conserved uncharacterized protein | -><- | 1548278 | 1548403 | 126 | 34.1% | 0 | 0 | 0 | +: 0/1/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
568 | SSA_1547 | HPr kinase/phosphorylase, putative | SSA_1548 | NTP pyrophosphohydrolases including oxidative damage repair enzymes, putative | <-<- | 1551071 | 1551208 | 138 | 26.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
569 | SSA_1548 | NTP pyrophosphohydrolases including oxidative damage repair enzymes, putative | SSA_1549 | hypothetical protein | <-<- | 1551701 | 1551905 | 205 | 28.8% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
570 | SSA_1549 | hypothetical protein | SSA_1550 | hypothetical protein | <-<- | 1552203 | 1552317 | 115 | 30.4% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
571 | SSA_1551 | Transcriptional accessory ribonuclease (YqgFc, S1), putative | SSA_1552 | hypothetical protein | <--> | 1554875 | 1555052 | 178 | 25.8% | 0 | 0 | 0 | +: 1/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
572 | SSA_1554 | hypothetical protein | SSA_1555 | Glucose-6-phosphate 1-dehydrogenase, putative | ->-> | 1556908 | 1557081 | 174 | 32.2% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
573 | SSA_1561 | Ribonuclease III, putative | SSA_1562 | hypothetical protein | <-<- | 1565974 | 1566094 | 121 | 36.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
574 | SSA_1565 | Two-component response transcriptional regulator (CheY-like receiver and winged-helix DNA-binding domains), putative | SSA_1566 | Polar amino acid ABC transporter, ATP-binding protein, putative | <--> | 1569400 | 1569738 | 339 | 30.4% | 0 | 0 | 0 | +: 1/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
575 | SSA_1569 | ABC transporter membrane-spanning permease, arginine/histidine transport, putative | SSA_1570 | hypothetical protein | ->-> | 1572691 | 1572798 | 108 | 35.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
576 | SSA_1570 | hypothetical protein | SSA_1571 | Threonyl-tRNA synthetase, putative | -><- | 1573198 | 1573300 | 103 | 31.1% | 0 | 0 | 0 | +: 0/2/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
577 | SSA_1572 | hypothetical protein | SSA_1573 | hypothetical protein | <-<- | 1575999 | 1576143 | 145 | 40.7% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
578 | SSA_1576 | Catabolite control protein A, putative | SSA_1577 | Proline dipeptidase, putative | <--> | 1580272 | 1580433 | 162 | 29.6% | 0 | 0 | 0 | +: 1/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
579 | SSA_1577 | Proline dipeptidase, putative | SSA_1578 | ABC-type Fe3+-siderophore transport system, permease component, putative | ->-> | 1581517 | 1581942 | 426 | 32.2% | 0 | 0 | 0 | +: 1/1/1 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
580 | SSA_1582 | Esterase, alpha/beta hydrolase superfamily, putative | SSA_1583 | 6-O-methylguanine-DNA methyltransferase, putative | -><- | 1585504 | 1585612 | 109 | 34.9% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
581 | SSA_1585 | hypothetical protein | SSA_1586 | hypothetical protein | <-<- | 1587695 | 1587819 | 125 | 26.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
582 | SSA_1589 | ABC-type antimicrobial peptide transport system, ATPase component, putative | SSA_1590 | Transcriptional regulator, TetR/AcrR family, putative | <--> | 1592699 | 1592841 | 143 | 26.6% | 0 | 0 | 0 | +: 1/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
583 | SSA_1591 | Dipeptidase, putative | SSA_1592 | hypothetical protein | <-<- | 1595542 | 1595665 | 124 | 26.6% | 0 | 0 | 0 | +: 0/0/0 | -: 1/1/0 | 1 | 0 | 0 | 0 | Result | |
584 | SSA_1593 | Dipeptidase, putative | SSA_1594 | Metalloendopeptidase, putative | <-<- | 1598145 | 1598546 | 402 | 34.8% | 0 | 0 | 0 | +: 1/0/0 | -: 1/4/4 | 1 | 0 | 0 | 0 | Result | |
585 | SSA_1594 | Metalloendopeptidase, putative | SSA_1595 | Tellurite resistance, putative | <-<- | 1600617 | 1601040 | 424 | 33.3% | 0 | 0 | 0 | +: 1/1/0 | -: 1/1/1 | 1 | 0 | 0 | 0 | Result | |
586 | SSA_1595 | Tellurite resistance, putative | SSA_1596 | hypothetical protein | <-<- | 1601905 | 1602164 | 260 | 34.6% | 0 | 0 | 0 | +: 0/1/0 | -: 1/2/2 | 1 | 0 | 0 | 0 | Result | |
587 | SSA_1596 | hypothetical protein | SSA_1597 | hypothetical protein | <-<- | 1603125 | 1603356 | 232 | 37.1% | 0 | 0 | 0 | +: 1/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
588 | SSA_1598 | hypothetical protein | SSA_1599 | hypothetical protein | <-<- | 1605329 | 1605531 | 203 | 37.4% | 0 | 0 | 0 | +: 0/0/0 | -: 1/1/0 | 1 | 0 | 0 | 0 | Result | |
589 | SSA_1603 | hypothetical protein | SSA_1604 | Protein-export membrane protein secG, putative | <-<- | 1610125 | 1610287 | 163 | 33.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
591 | SSA_1608 | hypothetical protein | SSA_1610 | hypothetical protein | <-<- | 1613844 | 1614093 | 250 | 40.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
592 | SSA_1610 | hypothetical protein | SSA_1611 | Era-like GTP-binding protein, putative | <-<- | 1615000 | 1615222 | 223 | 33.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
594 | SSA_1614 | Acetyltransferase, GNAT family, putative | SSA_1615 | Alanine dehydrogenase, putative | <--> | 1618136 | 1618265 | 130 | 30.8% | 0 | 0 | 0 | +: 1/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
595 | SSA_1616 | PhoH-like protein, putative | SSA_1617 | hypothetical protein | <-<- | 1620349 | 1620525 | 177 | 37.3% | 0 | 0 | 0 | +: 0/0/0 | -: 1/1/0 | 1 | 0 | 0 | 0 | Result | |
596 | SSA_1618 | hypothetical protein | SSA_1619 | Ribosome recycling factor, putative | <-<- | 1621665 | 1621768 | 104 | 35.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
597 | SSA_1620 | Uridylate kinase, putative | SSA_1621 | Amino acid transporter, putative | <-<- | 1623072 | 1623261 | 190 | 31.6% | 0 | 0 | 0 | +: 1/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
598 | SSA_1621 | Amino acid transporter, putative | SSA_1622 | 50S ribosomal protein L1, putative | <-<- | 1624714 | 1624841 | 128 | 28.1% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
599 | SSA_1622 | 50S ribosomal protein L1, putative | SSA_1623 | 50S ribosomal protein L11, putative | <-<- | 1625532 | 1625632 | 101 | 41.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
600 | SSA_1623 | 50S ribosomal protein L11, putative | SSA_1624 | hypothetical protein | <--> | 1626059 | 1626209 | 151 | 28.5% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
601 | SSA_1624 | hypothetical protein | SSA_1625 | Lactoylglutathione lyase, putative | -><- | 1626558 | 1626666 | 109 | 42.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
602 | SSA_1625 | Lactoylglutathione lyase, putative | SSA_1626 | DNA translocase ftsK, putative | <-<- | 1627054 | 1627166 | 113 | 39.8% | 0 | 0 | 0 | +: 0/1/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
603 | SSA_1626 | DNA translocase ftsK, putative | SSA_1627 | hypothetical protein | <-<- | 1629468 | 1629597 | 130 | 31.5% | 0 | 0 | 0 | +: 0/2/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
604 | SSA_1627 | hypothetical protein | SSA_1628 | MutT/nudix family protein, putative | <--> | 1629781 | 1630003 | 223 | 31.4% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
605 | SSA_1630 | hypothetical protein | SSA_1631 | Sortase-like protein, putative | -><- | 1631569 | 1631740 | 172 | 27.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
606 | SSA_1635 | hypothetical protein | SSA_1636 | ABC-type antibiotic exporter, ATPase component, putative | <-<- | 1639312 | 1639453 | 142 | 28.9% | 0 | 0 | 0 | +: 0/0/0 | -: 1/1/0 | 1 | 0 | 0 | 0 | Result | |
607 | SSA_1636 | ABC-type antibiotic exporter, ATPase component, putative | SSA_1638 | hypothetical protein | <-<- | 1640996 | 1641106 | 111 | 37.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
609 | SSA_1643 | hypothetical protein | SSA_1644 | hypothetical protein | <-<- | 1645360 | 1645560 | 201 | 36.3% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
610 | SSA_1651 | hypothetical protein | SSA_1652 | Acetyltransferases, putative | <-<- | 1649944 | 1650044 | 101 | 35.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
611 | SSA_1658 | Cationic amino acid transporter, putative | SSA_1659 | ABC-type antimicrobial peptide transport system, permease component, putative | <-<- | 1654765 | 1654920 | 156 | 33.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
612 | SSA_1660 | ABC-type antimicrobial peptide transport system, ATPase component, putative | SSA_1661 | hypothetical protein | <-<- | 1657671 | 1657848 | 178 | 36.5% | 0 | 0 | 0 | +: 0/1/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
613 | SSA_1661 | hypothetical protein | SSA_1662 | NADH-dependent oxidoreductase, putative | <-<- | 1658095 | 1658324 | 230 | 33% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
614 | SSA_1662 | NADH-dependent oxidoreductase, putative | SSA_1663 | Collagen-binding protein A | <-<- | 1659513 | 1659675 | 163 | 34.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
615 | SSA_1663 | Collagen-binding protein A | SSA_1664 | Phosphatidylethanolamine N-methyltransferase, putative | <-<- | 1664212 | 1664538 | 327 | 32.1% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
616 | SSA_1666 | Collagen-binding surface protein, putative | SSA_1667 | hypothetical protein | <-<- | 1667403 | 1667608 | 206 | 33.5% | 0 | 0 | 0 | +: 0/2/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
617 | SSA_1669 | hypothetical protein | SSA_1670 | Transcriptional regulator, TetR/AcrR family, putative | <-<- | 1668533 | 1668726 | 194 | 26.8% | 0 | 0 | 0 | +: 1/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
618 | SSA_1670 | Transcriptional regulator, TetR/AcrR family, putative | SSA_1671 | hypothetical protein | <--> | 1669339 | 1669443 | 105 | 25.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
619 | SSA_1679 | ABC-type multidrug transport system, ATPase component, putative | SSA_1680 | ABC-type bacitracin resistance protein A, permease component, putative | <-<- | 1673140 | 1673289 | 150 | 40% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
620 | SSA_1681 | ABC-type bacitracin resistance protein A, ATPase component, putative | SSA_1682 | hypothetical protein | <-<- | 1676051 | 1676219 | 169 | 39.1% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
621 | SSA_1682 | hypothetical protein | SSA_1683 | NrdI protein, putative | <-<- | 1676976 | 1677123 | 148 | 31.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
622 | SSA_1685 | Two-component response transcriptional regulator (CheY-like receiver and winged-helix DNA-binding domains), putative | SSA_1686 | hypothetical protein | <--> | 1679167 | 1679315 | 149 | 32.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
623 | SSA_1686 | hypothetical protein | SSA_1687 | NADH-binding ferric-oxidoreductase, putative | ->-> | 1680531 | 1680686 | 156 | 30.8% | 0 | 0 | 0 | +: 1/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
624 | SSA_1687 | NADH-binding ferric-oxidoreductase, putative | SSA_1689 | hypothetical protein | -><- | 1681884 | 1682034 | 151 | 36.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
625 | SSA_1689 | hypothetical protein | SSA_1690 | hypothetical protein | <--> | 1682596 | 1682880 | 285 | 23.2% | 0 | 0 | 0 | +: 2/0/0 | -: 2/0/0 | 1 | 0 | 0 | 0 | Result | |
626 | SSA_1695 | Transcriptional antiterminator, BglG/SacY family (induction of sugar metabolism), putative | SSA_1696 | Tagatose 1,6-diphosphate aldolase 2, putative | <-<- | 1688101 | 1688296 | 196 | 35.2% | 0 | 0 | 0 | +: 0/0/0 | -: 1/1/0 | 1 | 0 | 0 | 0 | Result | |
627 | SSA_1701 | Transcriptional repressor of sugar metabolism, GlpR/DeoR family, putative | SSA_1702 | hypothetical protein | <-<- | 1692145 | 1692286 | 142 | 27.5% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
628 | SSA_1702 | hypothetical protein | SSA_1703 | Methionyl-tRNA synthetase, putative | <-<- | 1693553 | 1693729 | 177 | 29.9% | 0 | 0 | 0 | +: 0/1/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
629 | SSA_1703 | Methionyl-tRNA synthetase, putative | SSA_1704 | Conserved uncharacterized protein | <-<- | 1695731 | 1695858 | 128 | 25% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
630 | SSA_1712 | Arsenate reductase (ArsC), glutaredoxin family, putative | SSA_1713 | D-3-phosphoglycerate dehydrogenase, putative | <-<- | 1700175 | 1700298 | 124 | 48.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
631 | SSA_1715 | Phosphoserine aminotransferase, putative | SSA_1716 | Restriction endonuclease SsuRB, putative | <-<- | 1702579 | 1702779 | 201 | 24.4% | 0 | 0 | 0 | +: 0/1/0 | -: 1/1/1 | 1 | 0 | 0 | 0 | Result | |
633 | SSA_1718 | Site-specific DNA-methyltransferase, putative | SSA_1719 | Conserved uncharacterized protein | <-<- | 1705902 | 1706013 | 112 | 22.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
634 | SSA_1722 | Thymidylate kinase, putative | SSA_1723 | hypothetical protein | <--> | 1708754 | 1709065 | 312 | 29.8% | 0 | 0 | 0 | +: 1/0/0 | -: 2/0/0 | 1 | 0 | 0 | 0 | Result | |
635 | SSA_1724 | CBS domain protein, putative | SSA_1725 | Branched-chain amino acid ABC transporter, ATP-binding protein, putative | <-<- | 1710644 | 1711082 | 439 | 34.4% | 0 | 0 | 0 | +: 0/3/0 | -: 2/4/8 | 1 | 0 | 0 | 0 | Result | |
636 | SSA_1728 | ABC transporter membrane-spanning permease-branched chain amino acid transport, putative | SSA_1729 | ABC transporter substrate-binding protein-branched chain amino acid transport, putative | <-<- | 1714384 | 1714628 | 245 | 33.9% | 0 | 0 | 0 | +: 1/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
637 | SSA_1730 | hypothetical protein | SSA_1731 | ATP-dependent Clp protease, proteolytic subunit, putative | <-<- | 1716148 | 1716307 | 160 | 40% | 0 | 0 | 0 | +: 0/0/0 | -: 1/1/0 | 1 | 0 | 0 | 0 | Result | |
638 | SSA_1731 | ATP-dependent Clp protease, proteolytic subunit, putative | SSA_1732 | Uracil phosphoribosyltransferase, putative | <-<- | 1716899 | 1717005 | 107 | 26.2% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
639 | SSA_1734 | Cation (Mg/Ni uptake) transport ATPase, putative | SSA_1735 | UreX, putative | <-<- | 1720394 | 1720550 | 157 | 38.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 2 | 30 | 142 | Result | tttcatacacagggaccaatcactttatgaggacagaacgacacaaatcagcgattggctgtgtatgtgcggttccggataatcgtcaatttgcatcgcatgtctcctttctt |
640 | SSA_1735 | UreX, putative | SSA_1736 | L-cysteine desulfhydrase, putative | <-<- | 1721163 | 1721542 | 380 | 38.9% | 0 | 0 | 0 | +: 0/1/0 | -: 1/3/0 | 1 | 2 | 163 | 297 | Result | cgttcaagctttaactccataaggcgatgaaatgagcttagtcttgaccttggcgatcaggactgttgaccaacgagtagtgtctccactgctttgcggtagtcatccgtatccttatggtagcctcacctaccg |
642 | SSA_1742 | Ferrichrome-binding protein, putative | SSA_1743 | ABC-type Fe3+-siderophore transport system, permease component, putative | ->-> | 1729948 | 1730309 | 362 | 43.6% | 0 | 0 | 1 | +: 0/2/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
644 | SSA_1748 | Inorganic pyrophosphatase/exopolyphosphatase, putative | SSA_1749 | Pyruvate formate-lyase-activating enzyme, putative | <-<- | 1734569 | 1734706 | 138 | 31.9% | 0 | 0 | 0 | +: 0/1/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
645 | SSA_1749 | Pyruvate formate-lyase-activating enzyme, putative | SSA_1750 | Extracellular nuclease, putative | <-<- | 1735517 | 1735762 | 246 | 31.3% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
646 | SSA_1750 | Extracellular nuclease, putative | SSA_1751 | Dextran glucosidase, alpha amylase family, putative | <-<- | 1738013 | 1738199 | 187 | 28.3% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
647 | SSA_1752 | Phosphotransferase system, trehalose-specific IIBC component, putative | SSA_1753 | Transcriptional regulator, GntR family (repressor of trehalose operon), putative | <--> | 1741966 | 1742083 | 118 | 28.8% | 0 | 0 | 0 | +: 1/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
648 | SSA_1753 | Transcriptional regulator, GntR family (repressor of trehalose operon), putative | SSA_1754 | hypothetical protein | -><- | 1742801 | 1743214 | 414 | 33.8% | 0 | 0 | 0 | +: 0/2/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
649 | SSA_1757 | hypothetical protein | SSA_1758 | hypothetical protein | <-<- | 1745981 | 1746100 | 120 | 23.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
651 | SSA_1760 | hypothetical protein | SSA_1761 | Hemolysin (containing CBS domains), putative | <-<- | 1747375 | 1747526 | 152 | 32.9% | 0 | 0 | 0 | +: 0/1/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
652 | SSA_1761 | Hemolysin (containing CBS domains), putative | SSA_1762 | Permease, putative | <-<- | 1748868 | 1749017 | 150 | 33.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
653 | SSA_1764 | hypothetical protein | SSA_2385 | hypothetical protein | ->-> | 1752571 | 1752681 | 111 | 20.7% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
654 | SSA_2385 | hypothetical protein | SSA_1765 | Conserved uncharacterized protein | ->-> | 1753057 | 1753175 | 119 | 29.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
655 | SSA_1765 | Conserved uncharacterized protein | SSA_1766 | Bacitracin ABC transporter, permease protein, putative | -><- | 1753941 | 1754477 | 537 | 36.1% | 0 | 0 | 0 | +: 0/2/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
656 | SSA_1768 | Transcriptional regulator, TetR/AcrR family, putative | SSA_1769 | hypothetical protein | <-<- | 1756790 | 1757028 | 239 | 28% | 0 | 0 | 0 | +: 0/0/0 | -: 1/2/0 | 1 | 0 | 0 | 0 | Result | |
657 | SSA_1773 | hypothetical protein | SSA_1774 | RRNA methylase, putative | <-<- | 1760183 | 1760578 | 396 | 40.2% | 0 | 0 | 0 | +: 0/0/0 | -: 1/1/0 | 1 | 19 | 135 | 277 | Result | tcgtcttctcccatccagactatactgtcggttgtggaatctcaccacatcagcttgcgctcgcggacttgatttgacatggagaaaaaaattccaatccaaaaattaccgccggtcgggaatctcaccctgccctgaagaca |
658 | SSA_1774 | RRNA methylase, putative | SSA_1775 | Potassium uptake protein, Trk family, putative | <--> | 1761134 | 1761423 | 290 | 30.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 2 | 1 | 108 | Result | tgcccggagtcaagctcagcaaacagcgtggttaaggcttcattaacttacatcacaacaggtttgaggtaaaccaatgaaggtactcatttagtataacactttcag |
660 | SSA_1787 | Diaminopimelate decarboxylase, putative | SSA_1788 | Integral membrane protein, possible receptor, putative | <-<- | 1771642 | 1771745 | 104 | 38.5% | 0 | 0 | 0 | +: 0/1/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
661 | SSA_1792 | Preprotein translocase subunit YidC, putative | SSA_1793 | Histidine kinase (sensor protein), putative | -><- | 1775100 | 1775215 | 116 | 31.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
662 | SSA_1795 | Guanosine 3',5'-bis-pyrophosphate (ppGpp) synthetase, putative | SSA_1796 | Transcription elongation factor GreA, putative | <-<- | 1777762 | 1777914 | 153 | 34% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
663 | SSA_1796 | Transcription elongation factor GreA, putative | SSA_1797 | Aminodeoxychorismate lyase, putative | <-<- | 1778398 | 1778537 | 140 | 33.6% | 0 | 0 | 0 | +: 0/2/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
664 | SSA_1800 | UDP-N-acetylmuramate--L-alanine ligase, putative | SSA_1801 | hypothetical protein | <-<- | 1782462 | 1782741 | 280 | 41.8% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
665 | SSA_1802 | Snf2 family protein, putative | SSA_1803 | GTP-binding protein, putative | <-<- | 1786561 | 1786688 | 128 | 29.7% | 0 | 0 | 0 | +: 0/0/0 | -: 1/2/0 | 1 | 0 | 0 | 0 | Result | |
666 | SSA_1807 | hypothetical protein | SSA_1808 | hypothetical protein | <-<- | 1791314 | 1791483 | 170 | 32.4% | 0 | 0 | 0 | +: 0/1/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
667 | SSA_1809 | PTS system glucose-specific EIIC BA component (EIICBA-Glc) (EII- Glc/EIII-Glc), putative | SSA_1810 | Two-component response transcriptional regulator (CheY-like receiver and winged-helix DNA-binding domains), putative | <-<- | 1794510 | 1794796 | 287 | 31.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
668 | SSA_1811 | 6-phosphogluconate dehydrogenase, putative | SSA_1812 | Modification methylase, putative | <-<- | 1796921 | 1797197 | 277 | 36.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
669 | SSA_1820 | hypothetical protein | SSA_1821 | Acetyltransferase (N-acetylase of ribosomal proteins), putative | <-<- | 1809913 | 1810136 | 224 | 33.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
670 | SSA_1821 | Acetyltransferase (N-acetylase of ribosomal proteins), putative | SSA_1822 | hypothetical protein | <-<- | 1810701 | 1810960 | 260 | 43.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 4 | 7 | 226 | Result | acctcactttccataaaaaagtccctgccatatccatgacagggacgaatcaatatccgcggtaccacccaatttcgggcaggcgcccgcaactctcgtctttgaagtaaatacaaagacacttttatttcatttttaaccatcagcaaccagtcttgacacatttgtggacttctcagcaccgccactttctgtaaaatgcttgactcaaaacacctct |
671 | SSA_1824 | hypothetical protein | SSA_1825 | hypothetical protein | <--> | 1812837 | 1813090 | 254 | 36.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
672 | SSA_1825 | hypothetical protein | SSA_1826 | Glycerol kinase, putative | ->-> | 1814519 | 1814675 | 157 | 29.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
673 | SSA_1828 | Glycerol uptake facilitator protein, putative | SSA_1829 | RNA methyltransferase, putative | -><- | 1818852 | 1819048 | 197 | 34% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
674 | SSA_1832 | hypothetical protein | SSA_1833 | hypothetical protein | ->-> | 1822675 | 1822801 | 127 | 39.4% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
679 | SSA_1837 | hypothetical protein | SSA_1839 | Cysteine synthase, putative | ->-> | 1833016 | 1833115 | 100 | 23% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
680 | SSA_1839 | Cysteine synthase, putative | SSA_1840 | RNA binding protein, putative | -><- | 1834046 | 1834149 | 104 | 28.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
681 | SSA_1844 | hypothetical protein | SSA_1845 | Serine/threonine protein kinase, putative | <-<- | 1838274 | 1838417 | 144 | 35.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
683 | SSA_1851 | Guanylate kinase, putative | SSA_1852 | Metal dependent phosphohydrolase (HD motif), putative | <-<- | 1846773 | 1846958 | 186 | 32.3% | 0 | 0 | 0 | +: 0/0/0 | -: 2/0/0 | 1 | 0 | 0 | 0 | Result | |
684 | SSA_1852 | Metal dependent phosphohydrolase (HD motif), putative | SSA_1853 | S-ribosylhomocysteine lyase, putative | <--> | 1848573 | 1848781 | 209 | 27.3% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
685 | SSA_1853 | S-ribosylhomocysteine lyase, putative | SSA_1854 | Conserved uncharacterized protein | -><- | 1849421 | 1849522 | 102 | 32.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
686 | SSA_1856 | hypothetical protein | SSA_1857 | Conserved DivIVA-like protein, putative | <-<- | 1852299 | 1852814 | 516 | 44.4% | 0 | 0 | 0 | +: 0/1/0 | -: 0/1/0 | 1 | 21 | 102 | 501 | Result | gtcctagcctcagcctatatgcaattttctgtaagccatgttttgttccggaaatgactaggtaccatttccttcgataatcatctgtctactgtttccagtcagagtgctatgttcgcttccacgcactccatgccccgaccaaagtttgggttgctagcttgaggggtttaccgcgttccacttcttctgtttccaaaagaactacgtcactgtggcactttcagacctaatcagacatatccaaagacttagccctttcagtcgccgtaacggaaaaatccgtccctaggcttatttcttcgcctagcacaaacactaccggcatcacagccagtgctagcatggactttcctcatgaaaatctaaaatttccacgcgattatccaaaaattgcact |
687 | SSA_1864 | Nicotinate phosphoribosyltransferase (NAPRTase), subgroup A, putative | SSA_1865 | Thioredoxin reductase, putative | <-<- | 1860961 | 1861067 | 107 | 31.8% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
688 | SSA_1866 | hypothetical protein | SSA_1867 | ABC-type polar amino acid transport system, ATPase component, putative | <-<- | 1862273 | 1862442 | 170 | 42.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
689 | SSA_1868 | ABC-type arginine/histidine transport system, permease component, putative | SSA_1869 | ATP-dependent RNA helicase, putative | <-<- | 1863993 | 1864241 | 249 | 28.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
690 | SSA_1869 | ATP-dependent RNA helicase, putative | SSA_1870 | Phospho-N-acetylmuramoyl-pentapeptide- transferase, putative | <-<- | 1865586 | 1865689 | 104 | 39.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
691 | SSA_1873 | S-adenosyl-methyltransferase mraW, putative | SSA_1874 | YorfE protein, putative | <--> | 1870235 | 1870434 | 200 | 24% | 0 | 0 | 0 | +: 1/2/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
692 | SSA_1881 | hypothetical protein | SSA_1882 | Subtilisin-like serine proteases, putative | <-<- | 1876055 | 1876366 | 312 | 39.4% | 0 | 0 | 0 | +: 0/1/0 | -: 1/2/0 | 1 | 3 | 4 | 144 | Result | tctcctttctttcgaacaatagactcagtacgcaaaagaaccacatccgacagtcctaggctattcacctaggggcgtcaagacgcggttccaccctaatttattacttcattacttttgaaattataaccgaaagcgcca |
693 | SSA_1882 | Subtilisin-like serine proteases, putative | SSA_1883 | hypothetical protein | <-<- | 1880888 | 1881663 | 776 | 35.1% | 0 | 0 | 0 | +: 0/1/0 | -: 3/1/3 | 1 | 0 | 0 | 0 | Result | |
694 | SSA_1884 | Conserved uncharacterized protein | SSA_1888 | hypothetical protein | <-<- | 1883055 | 1885179 | 2125 | 28% | 0 | 1 | 0 | +: 2/1/0 | -: 4/0/0 | 1 | 0 | 0 | 0 | Result | |
695 | SSA_1888 | hypothetical protein | SSA_1889 | Conserved uncharacterized protein | <-<- | 1886116 | 1886372 | 257 | 30.7% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
696 | SSA_1889 | Conserved uncharacterized protein | SSA_1890 | Acetyltransferase, putative | <-<- | 1887213 | 1887782 | 570 | 34.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
697 | SSA_1892 | hypothetical protein | SSA_1893 | N-acetylglucosamine-6-phosphate deacetylase, putative | <-<- | 1889353 | 1889510 | 158 | 37.3% | 0 | 0 | 0 | +: 0/0/0 | -: 2/1/1 | 1 | 0 | 0 | 0 | Result | |
698 | SSA_1893 | N-acetylglucosamine-6-phosphate deacetylase, putative | SSA_1895 | Ribosome-binding factor A, putative | <-<- | 1890663 | 1890904 | 242 | 31.4% | 0 | 0 | 0 | +: 1/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
699 | SSA_1895 | Ribosome-binding factor A, putative | SSA_1896 | Translation initiation factor IF-2, putative | <-<- | 1891256 | 1891431 | 176 | 32.4% | 0 | 0 | 0 | +: 0/1/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
700 | SSA_1901 | Conserved uncharacterized protein | SSA_1902 | tRNA (guanine-N(7)-)-methyltransferase, putative | <-<- | 1896690 | 1896842 | 153 | 35.9% | 0 | 0 | 0 | +: 0/2/0 | -: 1/1/1 | 1 | 0 | 0 | 0 | Result | |
701 | SSA_1907 | hypothetical protein | SSA_1909 | Transcriptional attenuator LytR, putative | -><- | 1900874 | 1900993 | 120 | 40.8% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
702 | SSA_1913 | Xanthine/uracil permease family protein, putative | SSA_1914 | hypothetical protein | <-<- | 1904757 | 1904901 | 145 | 22.8% | 0 | 0 | 0 | +: 1/0/0 | -: 1/1/0 | 1 | 0 | 0 | 0 | Result | |
703 | SSA_1916 | hypothetical protein | SSA_1917 | Alcohol dehydrogenase, propanol-preferring, putative | ->-> | 1906440 | 1906656 | 217 | 29.5% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
704 | SSA_1917 | Alcohol dehydrogenase, propanol-preferring, putative | SSA_1918 | Phosphotransferase system, mannose-specific EIIAB, putative | ->-> | 1907677 | 1908128 | 452 | 29% | 0 | 0 | 0 | +: 1/1/1 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
705 | SSA_1921 | hypothetical protein | SSA_1922 | hypothetical protein | -><- | 1911378 | 1911563 | 186 | 34.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
706 | SSA_1924 | Transcriptional regulator, TetR/AcrR family, putative | SSA_1925 | Seryl-tRNA synthetase, putative | <--> | 1913339 | 1913647 | 309 | 36.2% | 0 | 0 | 0 | +: 1/0/0 | -: 1/1/0 | 1 | 0 | 0 | 0 | Result | |
707 | SSA_1929 | Macrophage infectivity potentiator protein, putative | SSA_1930 | Acetyl-CoA carboxylase alpha subunit, putative | <-<- | 1917680 | 1917866 | 187 | 28.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
708 | SSA_1938 | Enoyl-acyl carrier protein(ACP) reductase, putative | SSA_1939 | Acyl carrier protein, putative | <-<- | 1925829 | 1925964 | 136 | 32.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
709 | SSA_1941 | hypothetical protein | SSA_1942 | Enoyl-CoA hydratase/carnithine racemase, putative | <-<- | 1927543 | 1927794 | 252 | 29.8% | 0 | 0 | 3 | +: 0/2/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
710 | SSA_1942 | Enoyl-CoA hydratase/carnithine racemase, putative | SSA_1943 | Aspartate kinase, putative | <--> | 1928587 | 1928836 | 250 | 24% | 0 | 0 | 0 | +: 2/0/0 | -: 1/1/0 | 1 | 0 | 0 | 0 | Result | |
715 | SSA_1948 | Oligopeptide-binding lipoprotein precursor, putative | SSA_1949 | AliA protein, putative | <-<- | 1942261 | 1942492 | 232 | 34.5% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
716 | SSA_1949 | AliA protein, putative | SSA_1950 | ABC-type oligopeptide transport system, periplasmic component, putative | <-<- | 1944464 | 1944655 | 192 | 34.4% | 0 | 0 | 0 | +: 0/3/0 | -: 1/1/1 | 1 | 0 | 0 | 0 | Result | |
717 | SSA_1950 | ABC-type oligopeptide transport system, periplasmic component, putative | SSA_1951 | Penicillin-binding protein 3, putative | <--> | 1946618 | 1946903 | 286 | 22.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
718 | SSA_1951 | Penicillin-binding protein 3, putative | SSA_1952 | ABC-type Fe-S cluster assembly transporter, permease component, putative | -><- | 1948164 | 1948301 | 138 | 37.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
719 | SSA_1958 | Adapter protein mecA, putative | SSA_1959 | Undecaprenyl-diphosphatase, putative | <-<- | 1955504 | 1955678 | 175 | 33.1% | 0 | 0 | 0 | +: 0/0/0 | -: 1/1/1 | 1 | 0 | 0 | 0 | Result | |
720 | SSA_1959 | Undecaprenyl-diphosphatase, putative | SSA_1960 | hypothetical protein | <-<- | 1956522 | 1956660 | 139 | 38.1% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
721 | SSA_1960 | hypothetical protein | SSA_1961 | Amino acid ABC transporter, amino acid-binding protein/permease protein, putative | <--> | 1958557 | 1958687 | 131 | 31.3% | 0 | 0 | 0 | +: 2/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
722 | SSA_1964 | conserved uncharacterized protein | SSA_1965 | Stomatin/prohibitin-like membrane protease subunits, putative | <-<- | 1961302 | 1961409 | 108 | 25.9% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
723 | SSA_1970 | Acetolactate synthase, large subunit, biosynthetic type, putative | SSA_1971 | hypothetical protein | <--> | 1967006 | 1967306 | 301 | 29.2% | 0 | 0 | 0 | +: 1/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
724 | SSA_1971 | hypothetical protein | SSA_1972 | Two-component system transcriptional regulator (CheY domain and HTH-like DNA-binding domain), putative | -><- | 1967658 | 1967900 | 243 | 34.2% | 0 | 0 | 0 | +: 0/1/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
725 | SSA_1975 | ABC-type multidrug transport system, ATPase component, putative | SSA_1976 | Conserved uncharacterized protein | <-<- | 1971223 | 1971639 | 417 | 35.5% | 0 | 0 | 0 | +: 0/1/0 | -: 2/1/1 | 1 | 0 | 0 | 0 | Result | |
727 | SSA_1979 | Alkaline-shock protein, putative | SSA_1980 | 50S ribosomal protein L28, putative | <-<- | 1974392 | 1974533 | 142 | 31% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
728 | SSA_1980 | 50S ribosomal protein L28, putative | SSA_1981 | hypothetical protein | <-<- | 1974723 | 1974848 | 126 | 33.3% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
729 | SSA_1982 | Transcriptional regulator, LytR/AlgR family, putative | SSA_1984 | Cell surface SD repeat antigen precursor, putative | <-<- | 1975964 | 1976137 | 174 | 42% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
730 | SSA_1984 | Cell surface SD repeat antigen precursor, putative | SSA_1985 | hypothetical protein | <-<- | 1979126 | 1979712 | 587 | 29% | 0 | 0 | 0 | +: 0/0/0 | -: 1/3/3 | 1 | 0 | 0 | 0 | Result | |
732 | SSA_1989 | ABC-type transport system (uncharacterized), ATPase component, putative | SSA_1990 | Zn-porter lipoprotein, putative | <-<- | 1985273 | 1985491 | 219 | 33.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
733 | SSA_1991 | Pneumococcal histidine triad protein A, putative | SSA_1992 | Fructose-bisphosphate aldolase, putative | <-<- | 1988863 | 1989180 | 318 | 23.9% | 0 | 0 | 0 | +: 0/2/0 | -: 1/1/0 | 1 | 0 | 0 | 0 | Result | |
736 | SSA_1994 | CTP synthase, putative | SSA_1995 | hypothetical protein | <-<- | 1992565 | 1992761 | 197 | 38.6% | 0 | 0 | 0 | +: 0/0/0 | -: 1/2/0 | 1 | 0 | 0 | 0 | Result | |
737 | SSA_1995 | hypothetical protein | SSA_1996 | DNA-directed RNA polymerase delta subunit, putative | <-<- | 1993449 | 1993568 | 120 | 30.8% | 0 | 0 | 0 | +: 0/1/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
738 | SSA_1996 | DNA-directed RNA polymerase delta subunit, putative | SSA_1997 | Membrane spanning protein, putative | <-<- | 1994115 | 1994251 | 137 | 28.5% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
739 | SSA_1997 | Membrane spanning protein, putative | SSA_1998 | Trigger factor, putative | <-<- | 1995002 | 1995137 | 136 | 39% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
740 | SSA_2002 | tRNA pseudouridine synthase A, putative | SSA_2004 | Zinc metalloprotease zmpB precursor, putative | <-<- | 1999050 | 1999305 | 256 | 38.3% | 0 | 0 | 0 | +: 0/1/0 | -: 1/2/1 | 1 | 0 | 0 | 0 | Result | |
741 | SSA_2004 | Zinc metalloprotease zmpB precursor, putative | SSA_2005 | Chaperone protein dnaJ, putative | <-<- | 2005021 | 2005340 | 320 | 29.1% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
742 | SSA_2005 | Chaperone protein dnaJ, putative | SSA_2006 | 4-methyl-5(B-hydroxyethyl)-thiazole monophosphate biosynthesis enzyme, putative | <-<- | 2006475 | 2006672 | 198 | 38.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 1 | 3 | 152 | Result | aagataccaagaccgtaaaattcgactgaaaaataggaaatcaggcgacggagcgatgcccctagacagatttctctcttttccgagaatttaggtcgggttcagttcctttcttttatattgagtcagaatttttggaacccgtgttca |
743 | SSA_2006 | 4-methyl-5(B-hydroxyethyl)-thiazole monophosphate biosynthesis enzyme, putative | SSA_2007 | Chaperone protein dnaK/HSP70, putative | <-<- | 2007306 | 2007532 | 227 | 40.5% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
744 | SSA_2007 | Chaperone protein dnaK/HSP70, putative | SSA_2008 | Molecular chaperone GrpE (HSP-70 cofactor), putative | <-<- | 2009363 | 2009615 | 253 | 39.5% | 0 | 0 | 0 | +: 1/1/0 | -: 0/1/0 | 1 | 3 | 30 | 234 | Result | ttttctttttgatactcttcttaggcggcgccgccgtcagagcttgactttatcaatctctttgactaaactttgagcctaaggtctcaaagtttgcgcgaatagcgccactgcgaagagtatcgtctttggctcgcttcgctcactattgcaaagctgaacaattttttatctttcttcatagtttattgtcgtctcggacaag |
745 | SSA_2009 | Heat shock transcription repressor HrcA, putative | SSA_2010 | ABC-type multidrug transport system, permease component, putative | <-<- | 2011223 | 2011385 | 163 | 38.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 1 | 29 | 163 | Result | tcgattagcactcaatcacctcgagtgctaactcatgattctattatacactcttctactccaaagtcaagacaaaaactcaaaaaattagcactctttttacaagagtgctaaaaatcagtctagcgacctaga |
746 | SSA_2013 | hypothetical protein | SSA_2014 | D-alanyl-D-alanine carboxypeptidase, putative | <-<- | 2013884 | 2014108 | 225 | 30.7% | 0 | 0 | 0 | +: 0/3/0 | -: 1/3/0 | 1 | 0 | 0 | 0 | Result | |
747 | SSA_2016 | Phosphoglycerate mutase, putative | SSA_2017 | Hypothetical protein (possibly membrane-associated) | <-<- | 2016384 | 2016524 | 141 | 36.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
748 | SSA_2017 | Hypothetical protein (possibly membrane-associated) | SSA_2018 | hypothetical protein | <-<- | 2017422 | 2017553 | 132 | 37.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
749 | SSA_2019 | hypothetical protein | SSA_2020 | hypothetical protein | <--> | 2019169 | 2019423 | 255 | 31% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
750 | SSA_2022 | Transcriptional regulator, MerR family (multidrug-efflux transporter genes), putative | SSA_2023 | Fructan beta-fructosidase precursor, putative | -><- | 2024549 | 2024698 | 150 | 37.3% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
751 | SSA_2023 | Fructan beta-fructosidase precursor, putative | SSA_2024 | hypothetical protein | <-<- | 2028917 | 2029194 | 278 | 32% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
752 | SSA_2024 | hypothetical protein | SSA_2025 | Conserved hypothetical GTPase protein | <--> | 2029363 | 2029935 | 573 | 33.3% | 0 | 0 | 1 | +: 0/1/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
753 | SSA_2025 | Conserved hypothetical GTPase protein | SSA_2388 | hypothetical protein | -><- | 2031073 | 2031756 | 684 | 30.8% | 0 | 0 | 1 | +: 2/0/0 | -: 0/2/0 | 1 | 3 | 55 | 209 | Result | aaaaaagacatccaagagcaaactcttgaatgtctgtaaagtttgatataatcgtgttgattaacgttttgagaattgtgatgctttacgagctttcttaagacctggtttggaaagtatggatttcagttggactaaaaacagcgtaatatcaa |
754 | SSA_2026 | Cadmium resistance transporter, putative | SSA_2027 | P-type ATPase-metal/cation transport (probably copper), putative | <-<- | 2032912 | 2033198 | 287 | 32.4% | 0 | 0 | 0 | +: 0/0/0 | -: 2/1/1 | 1 | 0 | 0 | 0 | Result | |
757 | SSA_2030 | hypothetical protein | SSA_2031 | Conserved domain uncharacterized protein | <--> | 2036841 | 2037292 | 452 | 39.6% | 0 | 9 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
758 | SSA_2031 | Conserved domain uncharacterized protein | SSA_2032 | Integrase/recombinase, phage integrase family, putative | ->-> | 2037902 | 2038145 | 244 | 32.8% | 0 | 0 | 0 | +: 0/2/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
759 | SSA_2032 | Integrase/recombinase, phage integrase family, putative | SSA_2033 | 30S ribosomal protein S9, putative | -><- | 2038368 | 2038476 | 109 | 32.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 3 | 3 | 109 | Result | gggtgaatatggggtgaattttggggtgaactttgattttttgaaacaaaaaagacatccaagaaataattcttgaatgtctgtaaacgttgatataatcgtattga |
760 | SSA_2034 | 50S ribosomal protein L13, putative | SSA_2035 | Conserved uncharacterized protein | <-<- | 2039335 | 2039514 | 180 | 37.8% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 3 | 18 | 119 | Result | tcgtttttgtttacagggcggatgttccggtccgcgagttatttgaaaggttccggggccttacaaatggggtaaacaataccgcctactatcatatcaaaa |
761 | SSA_2037 | tRNA (Guanosine-2'-O-)-methyltransferase, TrmH family, putative | SSA_2038 | hypothetical protein | <--> | 2041615 | 2041766 | 152 | 44.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
762 | SSA_2039 | Aminoacid specific permease, putative | SSA_2040 | ABC transporter ATP-binding protein-multiple sugar transport, putative | <-<- | 2044546 | 2044657 | 112 | 36.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
763 | SSA_2040 | ABC transporter ATP-binding protein-multiple sugar transport, putative | SSA_2041 | Leucine-rich protein, putative | <-<- | 2045789 | 2045896 | 108 | 30.6% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
764 | SSA_2049 | Polyribonucleotide nucleotidyltransferase, putative | SSA_2050 | Arabinose efflux permease, putative | <--> | 2052985 | 2053394 | 410 | 34.1% | 0 | 0 | 0 | +: 2/1/1 | -: 2/0/0 | 1 | 0 | 0 | 0 | Result | |
765 | SSA_2050 | Arabinose efflux permease, putative | SSA_2051 | Oligoendopeptidase, putative | ->-> | 2054757 | 2054870 | 114 | 33.3% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
766 | SSA_2051 | Oligoendopeptidase, putative | SSA_2052 | Thioredoxin, putative | -><- | 2056668 | 2057282 | 615 | 32.8% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
767 | SSA_2055 | hypothetical protein | SSA_2056 | Cinnamoyl ester hydrolase, putative | <--> | 2058251 | 2058726 | 476 | 37.4% | 0 | 0 | 4 | +: 1/0/0 | -: 2/1/2 | 1 | 0 | 0 | 0 | Result | |
768 | SSA_2056 | Cinnamoyl ester hydrolase, putative | SSA_2058 | 30S ribosomal protein S15, putative | -><- | 2059654 | 2060147 | 494 | 39.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/6/0 | 1 | 5 | 151 | 494 | Result | aaaaagcactctacaaataagagtgctccattcttgcaggataaaatgtttctagacaaggcgacgagccgaagattgtactaaaattctcttaaaaaataaaaaatctcccctaagggagaagatttggtttattttaccttacagtgctaggaaccgtaaccgaagataatacttgagtatatcgaggtaaggtgacggaacagaaaaagctccctgaagtcagagagccaatttgagctcgggctaaaatcctagtgaaaaagatgaaactccttgtgttcatcgaacacggtgtcgtttccctattttcatacggatttttgacgcccttagcatcatga |
769 | SSA_2058 | 30S ribosomal protein S15, putative | SSA_2059 | 16S rRNA uridine-516 pseudouridylate synthase, putative | <-<- | 2060445 | 2060583 | 139 | 40.3% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
770 | SSA_2060 | Arabinose efflux permease, putative | SSA_2061 | Peptide deformylase, putative | <--> | 2062494 | 2062686 | 193 | 39.4% | 0 | 0 | 0 | +: 1/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
771 | SSA_2066 | DNA polymerase III polC-type, putative | SSA_2067 | hypothetical protein | <--> | 2070228 | 2070393 | 166 | 35.5% | 0 | 0 | 0 | +: 0/0/0 | -: 2/1/0 | 1 | 0 | 0 | 0 | Result | |
772 | SSA_2073 | Undecaprenyl pyrophosphate synthetase, putative | SSA_2074 | Preprotein translocase subunit YajC, putative | <-<- | 2076462 | 2076689 | 228 | 38.2% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
773 | SSA_2074 | Preprotein translocase subunit YajC, putative | SSA_2075 | Transketolase, putative | <-<- | 2077026 | 2077202 | 177 | 36.2% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
774 | SSA_2075 | Transketolase, putative | SSA_2076 | Conserved uncharacterized protein | <-<- | 2079180 | 2079479 | 300 | 31.7% | 0 | 0 | 0 | +: 0/1/0 | -: 1/2/0 | 1 | 0 | 0 | 0 | Result | |
775 | SSA_2076 | Conserved uncharacterized protein | SSA_2077 | hypothetical protein | <-<- | 2080572 | 2081441 | 870 | 39.2% | 1 | 0 | 0 | +: 2/5/4 | -: 1/4/0 | 1 | 2 | 719 | 870 | Result | gataaattgagtgtaaaagaatatgaggattcctttagggatagtggtaagtaatgcaaacacctctttgagaggtttgtgacgagtcaagagcaatgaggcttgaacaaagtgaaagccagcgtctttaggcgctggctggtgatgtgggc |
776 | SSA_2078 | hypothetical protein | SSA_2079 | Acetyltransferase, putative | <--> | 2083928 | 2084110 | 183 | 36.1% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
778 | SSA_2086 | hypothetical protein | SSA_2087 | Conserved uncharacterized protein | <-<- | 2091519 | 2091763 | 245 | 32.2% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
779 | SSA_2087 | Conserved uncharacterized protein | SSA_2088 | Carbohydrate isomerase, AraD/FucA family, putative | <-<- | 2092748 | 2092855 | 108 | 31.5% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
780 | SSA_2091 | Phosphotransferase system sugar-specific EII component, putative | SSA_2092 | Phosphotransferase system sugar-specific EII component, putative | <-<- | 2095653 | 2095786 | 134 | 44.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
781 | SSA_2093 | PTS system, membrane component, putative | SSA_2094 | Conserved uncharacterized protein | <-<- | 2097553 | 2098079 | 527 | 42.7% | 0 | 0 | 0 | +: 0/1/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
782 | SSA_2094 | Conserved uncharacterized protein | SSA_2096 | ATP-dependent protease, ATP-binding subunit, putative | <-<- | 2098338 | 2099646 | 1309 | 34.9% | 0 | 0 | 8 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
783 | SSA_2096 | ATP-dependent protease, ATP-binding subunit, putative | SSA_2097 | Amino acid ABC transporter, ATP-binding protein, putative | <-<- | 2101786 | 2102243 | 458 | 26.6% | 0 | 0 | 0 | +: 1/0/0 | -: 1/2/0 | 1 | 0 | 0 | 0 | Result | |
784 | SSA_2099 | ABC-type arginine/histidine transporter, permease protein, putative | SSA_2101 | Amino acid ABC transporter, periplasmic amino acid-binding protein, putative | <-<- | 2104404 | 2104598 | 195 | 42.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
785 | SSA_2105 | hypothetical protein | SSA_2106 | Flavin monoxygenase, putative | <-<- | 2107893 | 2108104 | 212 | 31.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
786 | SSA_2106 | Flavin monoxygenase, putative | SSA_2107 | Glucosamine--fructose-6-phosphate aminotransferase [isomerizing], putative | <-<- | 2109155 | 2109384 | 230 | 34.8% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
787 | SSA_2107 | Glucosamine--fructose-6-phosphate aminotransferase [isomerizing], putative | SSA_2108 | Glyceraldehyde 3-phosphate dehydrogenase, putative | <-<- | 2111197 | 2111546 | 350 | 31.4% | 0 | 0 | 0 | +: 0/1/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
788 | SSA_2108 | Glyceraldehyde 3-phosphate dehydrogenase, putative | SSA_2109 | Elongation factor G, putative | <-<- | 2112555 | 2112876 | 322 | 31.1% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
789 | SSA_2109 | Elongation factor G, putative | SSA_2110 | 30S ribosomal protein S7, putative | <-<- | 2114959 | 2115198 | 240 | 32.9% | 0 | 0 | 0 | +: 0/0/0 | -: 1/1/0 | 1 | 0 | 0 | 0 | Result | |
790 | SSA_2112 | hypothetical protein | SSA_2113 | hypothetical protein | <-<- | 2116182 | 2116317 | 136 | 36% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
791 | SSA_2120 | GTPase, putative | SSA_2121 | Cell wall surface anchor family protein, putative | <-<- | 2121842 | 2122311 | 470 | 38.7% | 0 | 0 | 69 | +: 0/2/0 | -: 0/3/0 | 1 | 0 | 0 | 0 | Result | |
793 | SSA_2128 | hypothetical protein | SSA_2129 | Arsenical resistance operon transcription repressor (ArsR), putative | <-<- | 2132183 | 2132312 | 130 | 24.6% | 0 | 0 | 0 | +: 0/0/0 | -: 1/2/0 | 1 | 0 | 0 | 0 | Result | |
794 | SSA_2129 | Arsenical resistance operon transcription repressor (ArsR), putative | SSA_2130 | hypothetical protein | <--> | 2133399 | 2133603 | 205 | 28.8% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
795 | SSA_2132 | Ure cluster protein, putative | SSA_2133 | 3-methyladenine DNA glycosylase, putative | -><- | 2135726 | 2135856 | 131 | 31.3% | 0 | 0 | 0 | +: 0/2/0 | -: 1/1/0 | 1 | 0 | 0 | 0 | Result | |
796 | SSA_2136 | 50S ribosomal protein L34, putative | SSA_2137 | hypothetical protein | <-<- | 2137732 | 2137869 | 138 | 33.3% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
797 | SSA_2140 | Ribonuclease P protein component, putative | SSA_2141 | Argininosuccinate lyase, putative | <-<- | 2140665 | 2140908 | 244 | 33.2% | 0 | 0 | 0 | +: 0/1/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
798 | SSA_2142 | Argininosuccinate synthase, putative | SSA_2143 | Conserved uncharacterized protein | <-<- | 2143506 | 2143679 | 174 | 24.7% | 0 | 0 | 0 | +: 0/1/0 | -: 2/0/0 | 1 | 0 | 0 | 0 | Result | |
799 | SSA_2144 | Glutamyl-tRNA synthetase, putative | SSA_2145 | Tributyrin esterase, putative | <-<- | 2145863 | 2145968 | 106 | 36.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
800 | SSA_2146 | Metallo-beta-lactamase, putative | SSA_2147 | Conserved uncharacterized protein | <-<- | 2148490 | 2149258 | 769 | 30.8% | 0 | 0 | 0 | +: 1/3/3 | -: 2/6/7 | 1 | 0 | 0 | 0 | Result | |
801 | SSA_2150 | hypothetical protein | SSA_2151 | M protein trans-acting positive transcriptional regulator (MGA), putative | <--> | 2151207 | 2151499 | 293 | 21.5% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
802 | SSA_2151 | M protein trans-acting positive transcriptional regulator (MGA), putative | SSA_2152 | ABC-type transporter (uncharacterized), ATPase component, putative | -><- | 2152982 | 2153132 | 151 | 29.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
803 | SSA_2154 | Conserved uncharacterized protein | SSA_2155 | hypothetical protein | <-<- | 2155350 | 2155496 | 147 | 34% | 0 | 0 | 0 | +: 1/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
804 | SSA_2155 | hypothetical protein | SSA_2156 | Conserved uncharacterized protein | <-<- | 2156193 | 2156305 | 113 | 33.6% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
805 | SSA_2156 | Conserved uncharacterized protein | SSA_2157 | ATP-dependent serine protease, putative | <-<- | 2157023 | 2157137 | 115 | 31.3% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
807 | SSA_2164 | Glutamine amidotransferase, putative | SSA_2165 | ABC-type oligopeptide transporter, periplasmic component, putative | <--> | 2161646 | 2161873 | 228 | 28.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
808 | SSA_2165 | ABC-type oligopeptide transporter, periplasmic component, putative | SSA_2166 | ABC-type multidrug transporter, ATPase and permease components, putative | -><- | 2163848 | 2163962 | 115 | 33% | 0 | 0 | 0 | +: 0/1/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
809 | SSA_2167 | ABC-type multidrug transporter, ATPase and permease components, putative | SSA_2168 | Glycerol-3-phosphate dehydrogenase [NAD(P)+], putative | <--> | 2167462 | 2167600 | 139 | 26.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
810 | SSA_2169 | Glucose-1-phosphate uridylyltransferase, putative | SSA_2170 | hypothetical protein | -><- | 2169546 | 2169646 | 101 | 25.7% | 0 | 0 | 0 | +: 0/2/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
811 | SSA_2174 | 2,3,4,5-tetrahydropyridine-2-carboxylate N-succinyltransferase, putative | SSA_2175 | hypothetical protein | <-<- | 2172780 | 2173235 | 456 | 35.1% | 0 | 0 | 0 | +: 1/1/1 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
812 | SSA_2175 | hypothetical protein | SSA_2176 | hypothetical protein | <-<- | 2174133 | 2174358 | 226 | 34.1% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
813 | SSA_2178 | hypothetical protein | SSA_2179 | Conserved uncharacterized protein | <-<- | 2177686 | 2178193 | 508 | 32.1% | 0 | 0 | 0 | +: 0/0/0 | -: 1/1/0 | 1 | 0 | 0 | 0 | Result | |
814 | SSA_2182 | hypothetical protein | SSA_2183 | Glucose-6-phosphate isomerase, putative | <-<- | 2181111 | 2181244 | 134 | 29.1% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
815 | SSA_2183 | Glucose-6-phosphate isomerase, putative | SSA_2184 | hypothetical protein | <-<- | 2182628 | 2183373 | 746 | 38.2% | 0 | 0 | 0 | +: 0/2/0 | -: 1/2/0 | 1 | 0 | 0 | 0 | Result | |
816 | SSA_2184 | hypothetical protein | SSA_2185 | Adenylosuccinate synthetase, putative | <-<- | 2183845 | 2184087 | 243 | 32.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/4/0 | 1 | 0 | 0 | 0 | Result | |
817 | SSA_2185 | Adenylosuccinate synthetase, putative | SSA_2186 | Glutathione biosynthesis bifunctional protein gshAB (Gamma-GCS-GS) (GCS-GS), putative | <--> | 2185381 | 2185674 | 294 | 29.9% | 0 | 0 | 0 | +: 0/1/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
818 | SSA_2186 | Glutathione biosynthesis bifunctional protein gshAB (Gamma-GCS-GS) (GCS-GS), putative | SSA_2187 | Conserved hypothetical membrane associated protein | ->-> | 2187931 | 2188165 | 235 | 30.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
819 | SSA_2189 | hypothetical protein | SSA_2190 | 33 kDa chaperonin, putative | <--> | 2191188 | 2191305 | 118 | 33.1% | 0 | 0 | 0 | +: 0/2/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
820 | SSA_2192 | Conserved uncharacterized protein | SSA_2193 | ADP-ribose pyrophosphatase, putative | <-<- | 2193933 | 2194100 | 168 | 28% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
822 | SSA_2200 | Firmicutes transcriptional repressor of class III stress genes (CtsR), putative | SSA_2201 | hypothetical protein | <--> | 2201664 | 2201946 | 283 | 34.3% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
825 | SSA_2205 | Transcription antitermination factor NusG, putative | SSA_2207 | hypothetical protein | <-<- | 2206191 | 2206957 | 767 | 35.5% | 0 | 0 | 0 | +: 1/3/2 | -: 0/1/0 | 2 | 0 | 0 | 0 | Result | |
826 | SSA_2206 | hypothetical protein | SSA_2208 | Preprotein translocase secE component, putative | -><- | 2207336 | 2207823 | 488 | 35.2% | 0 | 0 | 0 | +: 1/1/1 | -: 3/5/4 | 1 | 0 | 0 | 0 | Result | |
828 | SSA_2209 | Penicillin-binding protein 2A, putative | SSA_2210 | Ribosomal large subunit pseudouridine synthase D, putative | <--> | 2210463 | 2210614 | 152 | 32.9% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
829 | SSA_2211 | Transmembrane protein, putative | SSA_2212 | Possible polysaccharide transport protein, putative | <-<- | 2212564 | 2212716 | 153 | 35.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
830 | SSA_2212 | Possible polysaccharide transport protein, putative | SSA_2213 | Nucleotide sugar dehydratase, putative | <-<- | 2214019 | 2214136 | 118 | 33.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
831 | SSA_2225 | Transcriptional attenuator LytR, putative | SSA_2226 | Organic radical activating chaperone, putative | <-<- | 2227038 | 2227240 | 203 | 23.2% | 0 | 0 | 0 | +: 1/1/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
832 | SSA_2230 | Ribonucleotide reductase, class III, anaerobic, putative | SSA_2231 | Heme/copper-type cytochrome/quinol oxidases, subunit 1, putative | <-<- | 2231249 | 2231470 | 222 | 30.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
833 | SSA_2233 | hypothetical protein | SSA_2234 | Phosphatidylserine/phosphatidylglycerophosphate/ cardiolipin synthase, phospholipase D family, putative | <-<- | 2233201 | 2233330 | 130 | 33.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
834 | SSA_2234 | Phosphatidylserine/phosphatidylglycerophosphate/ cardiolipin synthase, phospholipase D family, putative | SSA_2235 | Conserved uncharacterized protein | <-<- | 2234867 | 2235060 | 194 | 34% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
835 | SSA_2237 | Dihydrofolate:folylpolyglutamate synthetase, putative | SSA_2239 | Conserved uncharacterized cytosolic protein | <-<- | 2236831 | 2237011 | 181 | 44.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
836 | SSA_2241 | Conserved uncharacterized protein | SSA_2242 | hypothetical protein | <-<- | 2238034 | 2238210 | 177 | 33.3% | 0 | 0 | 0 | +: 0/0/0 | -: 2/0/0 | 1 | 0 | 0 | 0 | Result | |
837 | SSA_2242 | hypothetical protein | SSA_2243 | Conserved uncharacterized protein | <-<- | 2238754 | 2238858 | 105 | 32.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
838 | SSA_2243 | Conserved uncharacterized protein | SSA_2244 | Arsenate reductase, putative | <-<- | 2239432 | 2239566 | 135 | 44.4% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
839 | SSA_2246 | Competence-damage protein, putative | SSA_2247 | hypothetical protein | <--> | 2242587 | 2242784 | 198 | 29.3% | 0 | 0 | 0 | +: 1/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
840 | SSA_2247 | hypothetical protein | SSA_2248 | hypothetical protein | -><- | 2243196 | 2243407 | 212 | 31.6% | 0 | 0 | 0 | +: 2/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
841 | SSA_2250 | ABC-type antimicrobial peptide transporter, permease component, putative | SSA_2251 | hypothetical protein | <--> | 2246502 | 2247208 | 707 | 30.4% | 0 | 0 | 2 | +: 3/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
842 | SSA_2251 | hypothetical protein | SSA_2252 | hypothetical protein | -><- | 2248058 | 2248301 | 244 | 32% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
843 | SSA_2252 | hypothetical protein | SSA_2253 | 3-Methyladenine DNA glycosylase I, constitutive, putative | <-<- | 2248740 | 2248959 | 220 | 34.5% | 0 | 0 | 0 | +: 0/0/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
844 | SSA_2254 | Holliday junction DNA helicase ruvA, putative | SSA_2255 | Transcriptional regulator, XRE family, putative | <--> | 2250115 | 2250283 | 169 | 37.3% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
845 | SSA_2257 | DNA mismatch repair protein, putative | SSA_2258 | hypothetical protein | <-<- | 2253275 | 2253478 | 204 | 37.3% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
846 | SSA_2259 | hypothetical protein | SSA_2260 | DNA mismatch repair protein hexA, putative | <-<- | 2255513 | 2255690 | 178 | 32% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
847 | SSA_2261 | Transcriptional repressor (arginine synthesis), putative | SSA_2262 | Arginyl-tRNA synthetase, putative | <--> | 2258757 | 2259056 | 300 | 31% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
848 | SSA_2264 | hypothetical protein | SSA_2265 | Maltodextrin phosphorylase, putative | <-<- | 2261848 | 2262025 | 178 | 36% | 0 | 0 | 0 | +: 0/1/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
849 | SSA_2266 | 4-alpha-glucanotransferase, putative | SSA_2267 | Lactose operon transcriptional repressor, LacI family, putative | <--> | 2265832 | 2266266 | 435 | 33.8% | 0 | 0 | 0 | +: 2/0/0 | -: 1/1/1 | 1 | 0 | 0 | 0 | Result | |
850 | SSA_2267 | Lactose operon transcriptional repressor, LacI family, putative | SSA_2268 | Type II secretory pathway, pullulanase PulA glycosidase, putative | ->-> | 2267251 | 2267367 | 117 | 42.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
851 | SSA_2270 | Aspartyl-tRNA synthetase, putative | SSA_2271 | hypothetical protein | <-<- | 2272159 | 2272327 | 169 | 37.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
852 | SSA_2271 | hypothetical protein | SSA_2272 | hypothetical protein | <-<- | 2272541 | 2272666 | 126 | 34.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
853 | SSA_2282 | Phage infection protein, putative | SSA_2283 | Conserved uncharacterized protein | <-<- | 2285428 | 2285626 | 199 | 32.2% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
854 | SSA_2283 | Conserved uncharacterized protein | SSA_2284 | Histidyl-tRNA synthetase, putative | <-<- | 2285915 | 2286081 | 167 | 26.9% | 0 | 0 | 0 | +: 0/0/0 | -: 1/1/0 | 1 | 0 | 0 | 0 | Result | |
855 | SSA_2284 | Histidyl-tRNA synthetase, putative | SSA_2285 | hypothetical protein | <--> | 2287363 | 2287543 | 181 | 35.4% | 0 | 0 | 0 | +: 1/1/1 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
856 | SSA_2286 | Dihydroxy-acid dehydratase, putative | SSA_2287 | 50S ribosomal protein L32, putative | <--> | 2289687 | 2289960 | 274 | 28.5% | 0 | 0 | 0 | +: 1/0/0 | -: 1/1/1 | 1 | 0 | 0 | 0 | Result | |
857 | SSA_2287 | 50S ribosomal protein L32, putative | SSA_2288 | Cadmium resistance transporter, putative | ->-> | 2290144 | 2290600 | 457 | 33.9% | 0 | 1 | 0 | +: 2/4/7 | -: 0/3/0 | 1 | 21 | 168 | 457 | Result | attcaatacgaatcaatacagaagaaaaacgctgatttcaagcgttttttctttttgccaaatgcgatatattgcactgtatttcaattcaaactctacctttttctctaccttttttagataaatatatcatctggatattgaagttaagccctgctataatttcgatggcagggctttttaatatttggtacactaccttcttatctatattttgatggagctgaagttgacatctacaaagtttaatgttagaatacattcaaaaatatatttgaatgaggtgtttt |
858 | SSA_2290 | hypothetical protein | SSA_2291 | hypothetical protein | ->-> | 2293025 | 2293343 | 319 | 31.3% | 0 | 0 | 0 | +: 0/2/0 | -: 0/0/0 | 1 | 2 | 85 | 319 | Result | gaacattatgccttatactgaatatatcaagaaaaactcttgataaaaattttaatagtccaaattgatggccatcaaaggacagattgaaacaaatatgatgatatgacgataaaggtcatgtcttgcatagaattgtttcgctgtttctttgttgtgccttttagcatactcagcgttcaatatttgctcattttgtttccttctgtccaaggacggaaaggagctcatcatt |
859 | SSA_2291 | hypothetical protein | SSA_2292 | DNA segregation ATPase FtsK/SpoIIIE-like protein, putative | ->-> | 2293794 | 2294312 | 519 | 37% | 0 | 0 | 6 | +: 0/0/0 | -: 1/0/0 | 1 | 2 | 3 | 107 | Result | cctcaaatccagtgtctctgtcactggattttttataaaaaaattaaaaatttaacaaataactttgcgtttggttgtctcattctccttagtaataaggaggtg |
860 | SSA_2293 | hypothetical protein | SSA_2294 | hypothetical protein | ->-> | 2296016 | 2296221 | 206 | 38.3% | 0 | 0 | 0 | +: 0/0/0 | -: 2/0/0 | 1 | 3 | 3 | 206 | Result | ccttggggctgtggcttgcgttaagcaaaagccagacagcccctttttatatttcttatctatcatgacctattggggttactacgacccccaataggtcaataatcaataatcacaaaaaattcaatttttttcaaaaaactttgcatctgacctgccatttctccttagtaatagagcccaaaagaaatgaggtaactgcct |
862 | SSA_2295 | Integrase/recombinase, phage integrase family, putative | SSA_2296 | Transcriptional regulator, XRE family, putative | -><- | 2298424 | 2298638 | 215 | 27.9% | 0 | 0 | 0 | +: 0/2/0 | -: 0/3/0 | 1 | 12 | 1 | 147 | Result | ctactctaccattcactctaccttttattaggtagcattctagaaacattgatgtaccaacgtttctaacagctaaaatagaaattatttaactcttacagaagttaaataatttatataacaaaaatcctttgaaatcaacatttc |
863 | SSA_2297 | hypothetical protein | SSA_2298 | Serine protease containing a PDZ domain, putative | <-<- | 2299463 | 2299658 | 196 | 29.1% | 0 | 0 | 0 | +: 1/0/0 | -: 1/1/1 | 1 | 0 | 0 | 0 | Result | |
864 | SSA_2300 | hypothetical protein | SSA_2301 | S-layer protein/ peptidoglycan endo-beta-N-acetylglucosaminidase, putative | <-<- | 2302599 | 2302758 | 160 | 42.5% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
865 | SSA_2305 | hypothetical protein | SSA_2307 | hypothetical protein | <-<- | 2308150 | 2308412 | 263 | 27% | 0 | 0 | 0 | +: 0/1/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
866 | SSA_2312 | hypothetical protein | SSA_2313 | hypothetical protein | <-<- | 2315372 | 2315494 | 123 | 33.3% | 0 | 0 | 0 | +: 0/3/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
867 | SSA_2314 | hypothetical protein | SSA_2315 | Conserved uncharacterized protein | <-<- | 2316426 | 2316576 | 151 | 30.5% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
868 | SSA_2315 | Conserved uncharacterized protein | SSA_2316 | General secretory pathway protein F, putative | <-<- | 2317036 | 2317205 | 170 | 40% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
869 | SSA_2318 | PilB-like pili biogenesis ATPase, putative | SSA_2320 | hypothetical protein | <-<- | 2321185 | 2322391 | 1207 | 31.7% | 0 | 0 | 0 | +: 1/4/2 | -: 4/3/2 | 1 | 0 | 0 | 0 | Result | |
870 | SSA_2320 | hypothetical protein | SSA_2321 | Cation (Co/Zn/Cd) efflux protein, putative | <-<- | 2325887 | 2326139 | 253 | 20.9% | 0 | 0 | 0 | +: 1/3/2 | -: 2/2/4 | 1 | 0 | 0 | 0 | Result | |
871 | SSA_2321 | Cation (Co/Zn/Cd) efflux protein, putative | SSA_2322 | Transcriptional regulator, TetR/AcrR family, putative | <--> | 2327016 | 2327183 | 168 | 37.5% | 0 | 0 | 0 | +: 1/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
872 | SSA_2325 | 3-methyladenine DNA glycosylase, putative | SSA_2327 | hypothetical protein | <--> | 2330812 | 2331064 | 253 | 27.3% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
873 | SSA_2327 | hypothetical protein | SSA_2328 | Transcriptional repressor of sugar metabolism, GlpR/DeoR family, putative | ->-> | 2331461 | 2331622 | 162 | 29.6% | 0 | 0 | 0 | +: 1/1/1 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
874 | SSA_2335 | D-Ala-teichoic acid biosynthesis protein, putative | SSA_2336 | Transcriptional regulator, PadR family, putative | <--> | 2338249 | 2338506 | 258 | 27.1% | 0 | 0 | 0 | +: 1/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
875 | SSA_2338 | Conserved uncharacterized protein | SSA_2339 | Microcin C7 resistance protein, putative | ->-> | 2340453 | 2340595 | 143 | 36.4% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
876 | SSA_2342 | SPX domain-like protein, putative | SSA_2343 | hypothetical protein | <-<- | 2343604 | 2343792 | 189 | 29.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
877 | SSA_2343 | hypothetical protein | SSA_2344 | hypothetical protein | <--> | 2346217 | 2346676 | 460 | 34.1% | 0 | 0 | 1 | +: 0/0/0 | -: 2/0/0 | 1 | 0 | 0 | 0 | Result | |
878 | SSA_2344 | hypothetical protein | SSA_2345 | hypothetical protein | ->-> | 2346827 | 2347058 | 232 | 34.5% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
879 | SSA_2345 | hypothetical protein | SSA_2346 | 3-oxoacyl-[acyl-carrier-protein] synthase III, putative | -><- | 2347563 | 2347691 | 129 | 34.1% | 0 | 0 | 0 | +: 0/2/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
880 | SSA_2346 | 3-oxoacyl-[acyl-carrier-protein] synthase III, putative | SSA_2347 | Coenzyme F390 synthetase, putative | <-<- | 2348637 | 2348736 | 100 | 43% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
881 | SSA_2349 | DTDP-4-dehydrorhamnose 3,5-epimerase, putative | SSA_2350 | 30S ribosomal protein S4, putative | <-<- | 2351799 | 2352000 | 202 | 34.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
882 | SSA_2350 | 30S ribosomal protein S4, putative | SSA_2351 | ABC-type nitrate/sulfonate/bicarbonate transport system, ATPase component, putative | <-<- | 2352739 | 2352874 | 136 | 38.2% | 0 | 0 | 0 | +: 0/0/0 | -: 1/1/0 | 1 | 0 | 0 | 0 | Result | |
883 | SSA_2353 | ABC-type nitrate/sulfonate/bicarbonate transport system, permease component, putative | SSA_2354 | hypothetical protein | <-<- | 2355393 | 2355694 | 302 | 40.7% | 0 | 0 | 0 | +: 0/0/0 | -: 1/2/0 | 1 | 0 | 0 | 0 | Result | |
884 | SSA_2358 | hypothetical protein | SSA_2359 | Glucose inhibited division protein A, putative | <-<- | 2360588 | 2360702 | 115 | 35.7% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
885 | SSA_2359 | Glucose inhibited division protein A, putative | SSA_2360 | tRNA (5-methylaminomethyl-2-thiouridylate)-methyltransferase, putative | <-<- | 2362611 | 2362747 | 137 | 33.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
886 | SSA_2360 | tRNA (5-methylaminomethyl-2-thiouridylate)-methyltransferase, putative | SSA_2361 | L-serine dehydratase beta subunit | <--> | 2363870 | 2364167 | 298 | 31.5% | 0 | 0 | 0 | +: 1/0/0 | -: 2/2/0 | 1 | 0 | 0 | 0 | Result | |
887 | SSA_2363 | Phosphoglycolate phosphatase, putative | SSA_2364 | Immunodominant staphylococcal antigen A precursor, putative | -><- | 2366420 | 2366531 | 112 | 28.6% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
888 | SSA_2364 | Immunodominant staphylococcal antigen A precursor, putative | SSA_2365 | Cobalt transport protein cbiQ, putative | <-<- | 2367123 | 2367332 | 210 | 26.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
889 | SSA_2371 | Zn-dependent peptidase, putative | SSA_2372 | hypothetical protein | <--> | 2373772 | 2373946 | 175 | 32% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
890 | SSA_2373 | DNA replication and repair protein recF, putative | SSA_2374 | Inosine-5'-monophosphate dehydrogenase, putative | -><- | 2375443 | 2375623 | 181 | 25.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
891 | SSA_2374 | Inosine-5'-monophosphate dehydrogenase, putative | SSA_2375 | Tryptophanyl-tRNA synthetase, putative | <-<- | 2377106 | 2377310 | 205 | 25.4% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
892 | SSA_2375 | Tryptophanyl-tRNA synthetase, putative | SSA_2376 | ABC transporter with duplicated ATPase domains, putative | <--> | 2378337 | 2378883 | 547 | 31.8% | 0 | 14 | 0 | +: 2/0/0 | -: 1/1/0 | 1 | 0 | 0 | 0 | Result | |
895 | SSA_2380 | hypothetical protein | SSA_2381 | DegP protein, putative | <--> | 2386235 | 2386437 | 203 | 27.6% | 0 | 0 | 0 | +: 1/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
Total: | 1 | 10 | 0/41 | 822 | 38 |