Real time PCR (3/14/06)

·       Primers, TaqMan probes and PCR conditions

o      P. ramorum-specific primers and probe

o      P. pseudosyringae-specific primers and probe

·       Testing primers and probes with plant DNA.

·       Sensitivity of detection of real time PCR assay with infected tissue.

·       Evaluating field samples from California

·       Multiplex amplification

 

 

Primers, TaqMan probes and PCR conditions. 

 

P. ramorum

·       Primers

o      FMPr-1a (dGTATTTAAAATCATAGGTGTAATTTG)

o      FMPr-7 (dTGGTTTTTTTAATTTATATTATCAATG)

o      Amplicon 135 bp in size

·       Probe - 6-FAM d(CAGATATTAAACAAATTATATATAAAATCAAACAA) BHQ-1

o      TaqMan probes were labeled at the 5’ end with either the fluorescent reporter dye 6-carboxy-fluorescin (FAM) and labeled at the 3’ end with the black hole quencher dye (BHQ, Biosearch Technologies, Novato, CA)

 

P. pseudosyringae

·        Primers

o      FMPps-1 (dCAGTTTCATTAGAAGATTATTTAC)

o      FMPps-2 (dAAAATTGTTTGATTTTATTAAGTATC)

·       158 bp in size

·       Probe - CAL Orange d(TTAATAAAAAAATTATGATATTTAAACTAATTGGT) BHQ-1

o      TaqMan probes were labeled at the 5’ end with either the fluorescent reporter dye CAL Fluor Orange (CAL Orange) and labeled at the 3’ end with the black hole quencher dye (BHQ, Biosearch Technologies, Novato, CA).

 

Plant

·       Primers

o      FMPl-2b (dGCGTGGACCTGGAATGACTA)

o      FMPl-3b (dAGGTTGTATTAAAGTTTCGATCG)

§       143 bp in size

·       Probe - CAL Orange d(CTTTTATTATCACTTCCGGTACTGGCAGG) BHQ-1

o      TaqMan probes were labeled at the 5’ end with either the fluorescent reporter dye CAL Fluor Orange (CAL Orange) and labeled at the 3’ end with the black hole quencher dye (BHQ, Biosearch Technologies, Novato, CA).

 

The nucleotide sequences of the gene regions from which primer and probe sequences were designed are as described previously (Martin et al. 2004).  Primers were synthesized by Qiagen Inc. (Valencia, CA).  The TaqMan probes were labeled at the 5’ end with either the fluorescent reporter dye 6-carboxylfluoresceine (FAM) or CAL Fluor Orange 560 (CAL Orange) and labeled at the 3’ end with the black hole quencher dye (BHQ, Biosearch Technologies, Novato, CA).  In multiplex PCR experiments, the plant probe was labeled at the 5’ end with TAMRA (N,N,N’-tetramethyl-5-carboxyrhodamine) as a reporter dye instead of CAL Orange.

For multiplex reactions, we used conditions identical to those for duplex reactions except that 50 µl reaction volumes were used and the plant probe was at a concentration of 400 nM.  A water blank was included as a negative control in each experiment. 

 

NOTE: The TaqMan Universal Master Mix  from Applied Biosystems was used in this experimentation.  When the procedure was set up in the Martin lab using a Master Mix from Bio Rad background amplification was observed for several other species.

 

Specificity of P. ramorum-specific primers and probe.   A high level of P. ramorum specificity was observed using the primers FMPr-1a and FMPr-7 and the Pr-FAM probe when tested against 45 other species of Phytophthora (multiple isolates tested for some species) at a concentration of 100 pg DNA with an annealing temperature of 55º C.  Only P. ramorum showed a Ct value of less than 30 cycles with other species exhibiting no detection after 60 cycles (Fig. 1A, Table 2).  Twenty-five diverse isolates of P. ramorum were amplified at a concentration of 100 pg DNA using primers FMPR-1a and FMPr-7 and the Pr-FAM probe, with Ct values ranging from 22.56 to 28.91 (Table 2).  Primers FMPr-1a and FMPr-7 and the FAM probe worked successfully at 55º C, but at 57º C amplification became inconsistent (data not shown).  

            Results from real-time PCR based on a DNA dilution series showed that amplification with the P. ramorum primers and probe occurred down to 1 fg of template DNA, which had a Ct value of 42 (Fig. 2A).  A standard curve was calculated based on three replicate serial dilutions of DNA extracted from P. ramorum isolate 288 and demonstrated the linearity in response of the assay to DNA concentrations (Fig. 2B).   Data for the 100 ag quantity was omitted from the standard curve analysis since detection was variable at that low level.   Addition of plant DNA in amounts similar to those that would likely be added when assaying field samples slightly reduced the amplification efficiency of P. ramorum template amplification (slope of –4.14 compared to –3.68); the regression equation for the spiked DNA standard curve was y = -4.14 Log(x) + 21.96 with a r² value of 0.984.

 

P. pseudosyringae-specific primers and probe.  Primers FMPps1c and FMPps2c and the PpsCALOrange probe specifically detected all six isolates of P. pseudosyringae when tested at an annealing temperature of 55 ºC and did not amplify any of the other 45 Phytophthora species (including the closely related P. nemorosa) when tested at a concentration of 100 pg DNA, including 25 isolates of P. ramorum (Table 2).  Results of a DNA dilution series showed that amplification with the P. pseudosyringae primers and probe occurred down to 10 fg template DNA, which had an average Ct value (based on six replications) of 39.94 (data not shown).  A standard curve was calculated based on three replicate serial dilutions of P. pseudosyringae isolate 471 each containing two replications, and the regression demonstrated the linearity in response of the assay to DNA concentrations (Fig. 2C).   Data for the 1 fg quantity was omitted from the standard curve analysis since detection was variable at that low level.

 

TABLE 2.  Cycle threshold (Ct) values for 25 isolates of Phytophthora ramorum, Phytophthora pseudosyringae and other Phytophthora species subjected to real-time PCR analysis.

____________________________________________________________________

	Ct valuea
P. ramorum	P. ramorum primers and probe	P. pseudosyringae primers and probe
Coen	28.91 ± 0.44	>60 ± 0b
201C	26.40 ± 0.13	>60 ± 0
0-13	24.84 ± 0.46	>60 ± 0
0-16	26.83 ± 0.56	>60 ± 0
0-217	25.23 ± 0.11	>60 ± 0
288	28.81 ± 0.05	>60 ± 0
C	27.40 ±  0.75	>60 ± 0
73101	25.41±  0.55	>60 ± 0
044519	25.26 ±  0.13	>60 ± 0
044522	25.28±  0.44	>60 ± 0
Prn-1	25.66 ± 0.15	>60 ± 0
Prn-2	28.45 ± 0.69	>60 ± 0
Prn-3	28.87 ± 0.14	>60 ± 0
Prn-4	27.25 ± 0.01	>60 ± 0
Prn-5	26.73 ± 1.12	>60 ± 0
Prn-6	26.68 ± 0.18	>60 ± 0
Prg-1	26.88 ± 0.21	>60 ± 0
Prg-2	22.56 ± 0.11	>60 ± 0
Prg-3	24.86 ± 0.14	>60 ± 0
Prg-4	27.07 ± 0.18	>60 ± 0
Prg-5	27.49 ± 0.27	>60 ± 0
Prg-6	25.02 ± 0.15	>60 ± 0
Prg-7	28.53 ± 0.42	>60 ± 0
Prg-8	24.37 ± 0.52	>60 ± 0
P72648	25.66 ± 0.76	>60 ± 0
P. pseudosyringae
470	>60 ± 0	25.41± 0.03
471	>60 ± 0	25.01± 0.40
472	>60 ± 0	24.52 ± 0.64
473	>60 ± 0	24.11 ± 0.06
484	>60 ± 0	27.74 ± 0.33
485	>60 ± 0	24.93 ± 0.25
Other Phytophthora speciesc	>60 ± 0	>60 ± 0
negative control	>60 ± 0	>60 ± 0

____________________________________________________________________

^a Data are mean values of two replicated experiments ± standard error.

^b No fluorescence was detected at 60 cycles of PCR amplification when tested at a concentration of 100 pg DNA.

^c Other species listed in Table 1.

 

Testing primers and probes with plant DNA.  Both the P. ramorum and P. pseudosyringae primers and probes were also tested with DNA of the following plant species using an annealing temperature of 55ºC and no amplification was observed:  Rhododendron sp. ( cv. ‘Cunningham’s White’), Glycine max cv. ‘Williams’, Solanum demissum, Solanum cardiophyllum, Solanum tuberosum cv. ‘Russet Burbank’, Lycopersicon esculentum, coast live oak (Quercus agrifolia), laurel oak (Quercus laurifolia), Kalmia latifolia cv. ‘Olympic Wedding’, California bay laurel (Umbellularia californica), Pieris japonica, Highbush blueberry (Vacinnium corymbosum), Tan oak (Lithocarpus densiflorus), Citrus sp., Zauschneria californica, Fragaria x ananassa, and Juniperus sp.

 

 

Sensitivity of detection of real time PCR assay with infected tissue.  We performed a dilution series from rhododendron leaf disks artificially inoculated with P. ramorum to determine the approximate limits of pathogen detection in infected tissue (Table 3).  Even at dilutions of 10^-6 pathogen detection was observed, albeit with a C_t of 55.34.  The amount of DNA at each serial dilution of the infected plant extract was estimated using the standard dilution series curve (Fig. 2) with the 10^-5 dilution extrapolated to have 1.7 fg P. ramorum DNA. 

 

 

 TABLE 3.  Amount of DNA estimated to be present in dilutions of DNA extracted from Rhododendron sp. (cv. ‘Cunningham’s White’) leaf disks infected with Phytophthora ramorum.

Dilution from Bio101 kita	Ct avgb ± SE	Amt. DNA calculated from standard curve
1:10	27.75 ± 0.32	20.9 pg
1:100	32.06 ± 0.53	1.4 pg
1:1000	35.37 ± 0.62	177 fg
1:10,000	39.57 ± 0.33	13 fg
1:100,000	42.81 ± 0.58	1.7 fg
1:1,000,000	55.34 ± 2.95	NDc

^a  DNA was extracted from two 6-mm diameter leaf disks using a Qbiogene Fast DNA extraction kit according to manufacturer’s instructions.

^b Ct values are means of six observations, plus or minus the standard error.  Three separate extractions were performed (each using two 6-mm diameter leaf disks), and two replicate real-time PCR experiments were conducted, each containing sample from all three extractions diluted as indicated (n = 6).

^c ND = not determined due to out of range of the standard curve