PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure

Search Entrez NCBI Web site ------------- Books CloneRegistry Domains 3D Domains Gene Genome GEO GEO Datasets HomoloGene Journals MapViewer MeSH Nucleotide OMIM PMC PopSet Protein PubMed SNP Structure Taxonomy UniGene UniSTS for

Entrez UniSTS Help Query tips Submit Submit map FTP site Statistics Related sites e-PCR Map Viewer Gene UniGene dbSNP GeneMap'99 MGD ZFIN Genomic biology Bos taurus Canis familiaris Danio rerio Homo sapiens Mus musculus Rattus novegicus Sus scrofa

UniSTS:51232 Links 1626 Homo sapiens chromosome 16, locus CMTM4 Macaca mulatta chromosome 20, locus LOC695709 Pan troglodytes chromosome 16, locus CMTM4 Found by e-PCR in sequences from Homo sapiens and Pan troglodytes. Primer Information Forward primer: GGAACACTAGGCAAGTAGGA Reverse primer: GCTCATACTATGGATGCAGG PCR product size: 73-74 (bp), Homo sapiens    Homo sapiens Name: 1626 Also known as: 1625 D16S2925E GDB:581469 Polymorphism info:   Cross References Gene GeneID: 146223   Symbol: CMTM4   Description: CKLF-like MARVEL transmembrane domain containing 4   Position: 16q22.1 Mapping Information 1626 Sequence Map: Chr 16|Celera Map Viewer   Position: 51175414-51175487 (bp)   1626 Sequence Map: Chr 16|HuRef Map Viewer   Position: 52544703-52544776 (bp)   1626 Sequence Map: Chr 16 Map Viewer   Position: 65226424-65226497 (bp)   1625 NCBI RH Map: Chr 16 Map Viewer   Position: 508.6 (cR)   Lod score: 1.78   1625 GeneMap99-GB4 Map: Chr 16 Map Viewer   Position: 398.81 (cR3000)   Lod score: 0.63   Reference Interval: D16S3031-D16S3139 Electronic PCR results Genomic (5 of 8)[Show All Hits] AC010542.7 156922 .. 156995 (74 bp)   AC018557.9 73677 .. 73750 (74 bp)   CH003463.1 47832960 .. 47833033 (74 bp)   CH003511.1 49644754 .. 49644827 (74 bp)   CH471092.1 20240213 .. 20240286 (74 bp)     Working Draft phase 1 (from GenBank HTGS division) (1) AC018589.3 121177 .. 121250 (74 bp)     ESTs (1) M79112.1 251 .. 324 (74 bp)     Whole Genome Shotgun sequences (4) AADD01149425.1 3627 .. 3700 (74 bp)   AADC01126556.1 49794 .. 49867 (74 bp)   AADB02017577.1 207554 .. 207627 (74 bp)   ABBA01025410.1 4707 .. 4780 (74 bp)        Macaca mulatta Name: 1626 Polymorphism info:   Cross References Gene GeneID: 695709   Symbol: LOC695709   Description: similar to chemokine-like factor superfamily 4 isoform 1   Position:   Mapping Information 1626 Sequence Map: Chr 20 Map Viewer   Position: 64901388-64901461 (bp)    Pan troglodytes Name: 1626 Polymorphism info:   Cross References Gene GeneID: 467993   Symbol: CMTM4   Description: CKLF-like MARVEL transmembrane domain containing 4   Position:   Mapping Information 1626 Sequence Map: Chr 16 Map Viewer   Position: 66333988-66334061 (bp) Electronic PCR results Genomic (1) CM000330.1 66333988 .. 66334061 (74 bp)     Whole Genome Shotgun sequences (2) AADA01228730.1 283 .. 356 (74 bp)   AACZ02163585.1 22750 .. 22823 (74 bp)

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement