Zebrafish anterior segment (minus lens). Unnormalized (nap)

Library Description

Organism:	Danio rerio
Developmental stage:	Adult
Organ:	Eye
Vector:	pCMVSport6
Vector type:	Plasmid
Lab host:	EMDH10B

RNA was extracted from Zebrafish anterior segment (minus lens) tissue. A directionally cloned cDNA library in the pCMVSPORT6 vector (Invitrogen) was constructed at Bioserve Biotechnology (Laurel MD) essentially following the protocols of the SuperScript Plasmid System, full details of which are contained in the manufacturer's Instruction manual (http://www.lifetech.com/). First strand synthesis was carried out using a Not I primer-adapter [5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)15-3']. cDNA was cloned in Not I/Sal I sites. EST analysis was performed at the NIH Intramural Sequencing Center (NISC). Analyzed data available through http://neibank.nei.nih.gov.

Source: Wistow G, National Eye Institute

Gene Content Analysis

3,422 ESTs from this library were grouped into 2,196 UniGene entries (putative genes) [UniGene build #114, 18-Sep-2008]. EST counts for each entry may be used to calculate an approximate expression level in transcripts per million (TPM).

ESTs	TPM	UniGene Entry
62	18118	Dr.28410	Keratin 5.
60	17534	Dr.75268	Scinderin like a.
50	14611	Dr.140396	Zgc:92533.
37	10812	Dr.31797	Elongation factor 1-alpha.
35	10228	Dr.75123	Transcribed locus, strongly similar to NP_055278.1 Lsm3 protein [Homo sapiens].
22	6429	Dr.354	Rhodopsin.
22	6429	Dr.23502	Apolipoprotein Eb.
21	6137	Dr.75704	Prostaglandin D2 synthase.
20	5845	Dr.104534	D93 mRNA, 3'UTR, partial sequence.
16	4676	Dr.75125	Bactin2.
14	4091	Dr.75583	Ribosomal protein L3.
14	4091	Dr.32396	Similar to keratin 19.
13	3799	Dr.78537	Zgc:114181.
13	3799	Dr.104301	Si:dkey-7c18.24.
12	3507	Dr.104772	Zgc:195154.
11	3214	Dr.35143	Bactin1.
11	3214	Dr.32854	Ribosomal protein S2.
11	3214	Dr.23445	Ba1 globin, like.
10	2922	Dr.144276	Transcribed locus, strongly similar to NP_001007283.1 glutathione peroxidase 4 [Danio rerio].
9	2630	Dr.7740	Invariant chain-like protein 1.
9	2630	Dr.45971	Transcribed locus.
9	2630	Dr.35688	Heat shock protein 90kDa alpha (cytosolic), class B member 1.
9	2630	Dr.30295	Solute carrier family 25 alpha, member 5.
9	2630	Dr.12986	V-fos FBJ murine osteosarcoma viral oncogene homolog.
8	2338	Dr.76207	Aquaporin 3.
8	2338	Dr.75625	Creatine kinase, brain.
7	2046	Dr.9981	Wu:fk66f10.
7	2046	Dr.94047	Wu:fb11c03.
7	2046	Dr.77427	Hypothetical LOC791742.
7	2046	Dr.76738	Zgc:158768.
7	2046	Dr.76624	B-cell translocation gene 2.
7	2046	Dr.75127	Ribosomal protein SA.
7	2046	Dr.59	Annexin A1a.
7	2046	Dr.55617	Ribosomal protein, large, P0.
7	2046	Dr.51646	Beta-2-microglobulin.
7	2046	Dr.140308	Scinderin like a.
7	2046	Dr.1280	CCAAT/enhancer binding protein (C/EBP), delta.
7	2046	Dr.121604	Transcribed locus.
6	1753	Dr.78368	Death effector domain-containing 1.
6	1753	Dr.77881	Zgc:136474.
6	1753	Dr.76498	Zinc finger protein 36, C3H type-like 2.
6	1753	Dr.76134	Cyclin G1.
6	1753	Dr.75719	Invariant chain-like protein 2.
6	1753	Dr.75111	Keratin 4.
6	1753	Dr.70123	Proline-rich nuclear receptor coactivator 2.
6	1753	Dr.35139	Ribosomal protein L4.
6	1753	Dr.34905	Si:dkey-13i19.1.
6	1753	Dr.30332	Ribosomal protein L7.
6	1753	Dr.24504	Poly A binding protein, cytoplasmic 1 a.
6	1753	Dr.20097	Collagen, type I, alpha 1.
6	1753	Dr.11010	Major histocompatibility complex class I UEA gene.
6	1753	Dr.107259	Selenoprotein P, plasma, 1a.
5	1461	Dr.907	Ribosomal protein S3A.
5	1461	Dr.83363	Similar to NMDA receptor 1.
5	1461	Dr.77085	Zgc:194249.
5	1461	Dr.76397	Matrix metalloproteinase 2.
5	1461	Dr.76351	Decorin.
5	1461	Dr.76023	Hemoglobin alpha adult-1.
5	1461	Dr.76013	Claudin b.
5	1461	Dr.75945	Ribosomal protein L12.
5	1461	Dr.4091	Ribosomal protein L8.
5	1461	Dr.35072	Zgc:111961.
5	1461	Dr.33261	Major histocompatibility complex class I UFA gene.
5	1461	Dr.30707	PERP, TP53 apoptosis effector.
5	1461	Dr.2413	Dual specificity phosphatase 1.
5	1461	Dr.148426	Y box binding protein 1.
5	1461	Dr.141516	Transcribed locus, strongly similar to NP_001003822.1 hypothetical protein LOC368848 [Danio rerio].
5	1461	Dr.117711	Transcribed locus, strongly similar to NP_032169.1 guanine nucleotide binding protein (G protein), beta polypeptide 2 like 1 [Mus musculus].
5	1461	Dr.102919	Glycogenin, like.
5	1461	Dr.10032	Zgc:92851.
4	1169	Dr.99104	Transcribed locus, strongly similar to NP_001026846.1 poly A binding protein, cytoplasmic 1 a [Danio rerio].
4	1169	Dr.8194	Opsin 1 (cone pigments), short-wave-sensitive 1.
4	1169	Dr.81479	Si:ch211-235e18.3.
4	1169	Dr.80547	Zgc:76924.
4	1169	Dr.80246	Clusterin (complement lysis inhibitor, SP-40,40, sulfated glycoprotein 2, testosterone-repressed prostate message 2, apolipoprotein J).
4	1169	Dr.79005	Family with sequence similarity 107, member B.
4	1169	Dr.77541	Zgc:64115.
4	1169	Dr.76187	Keratin 15.
4	1169	Dr.76043	Zgc:92872.
4	1169	Dr.75657	Eukaryotic translation elongation factor 1 gamma.
4	1169	Dr.75575	Collagen, type I, alpha 2.
4	1169	Dr.75554	Secreted acidic cysteine rich glycoprotein.
4	1169	Dr.75253	Solute carrier family 25 (mitochondrial carrier: glutamate), member 22.
4	1169	Dr.75226	KH domain containing, RNA binding, signal transduction associated 1.
4	1169	Dr.75112	Eukaryotic translation elongation factor 2, like.
4	1169	Dr.74531	Syndecan 4 like.
4	1169	Dr.67796	Ictacalcin.
4	1169	Dr.65656	Ribosomal protein S3.
4	1169	Dr.53820	Ribosomal protein L7a.
4	1169	Dr.31395	Zgc:113912.
4	1169	Dr.28420	DEAD (Asp-Glu-Ala-Asp) box polypeptide 5.
4	1169	Dr.28231	Ribosomal protein L6.
4	1169	Dr.26808	Ribosomal protein L10a.
4	1169	Dr.26403	Ribosomal protein S4, X-linked.
4	1169	Dr.16301	Dual specificity phosphatase 6.
4	1169	Dr.15501	Zgc:85866.
4	1169	Dr.115545	Transcribed locus, strongly similar to NP_878286.1 glutamine synthetase [Danio rerio].
4	1169	Dr.11310	Similar to alpha-tubulin isotype M-alpha-2.
4	1169	Dr.107615	Zgc:92354.
4	1169	Dr.104642	Peptidylprolyl isomerase A (cyclophilin A).