PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure

Search Entrez NCBI Web site ------------- Books CloneRegistry Domains 3D Domains Gene Genome GEO GEO Datasets HomoloGene Journals MapViewer MeSH Nucleotide OMIM PMC PopSet Protein PubMed SNP Structure Taxonomy UniGene UniSTS for

Entrez UniSTS Help Query tips Submit Submit map FTP site Statistics Related sites e-PCR Map Viewer Gene UniGene dbSNP GeneMap'99 MGD ZFIN Genomic biology Bos taurus Canis familiaris Danio rerio Homo sapiens Mus musculus Rattus novegicus Sus scrofa

UniSTS:63161 Links D18S56 Homo sapiens chromosome 18, polymorphic Pan troglodytes chromosome 18 Found by e-PCR in sequences from Homo sapiens and Pan troglodytes. Primer Information Forward primer: TATCTCCTGAAGGACCTGCC Reverse primer: CTGCCAGTTGTATAAACGCC PCR product size: 196-209 (bp), Homo sapiens GenBank Accession: Z16631    Homo sapiens Name: D18S56 Also known as: 123YA1 AFM123ya1 GC378-D18S56 GDB:188034 HS123YA1 Polymorphism info: on genetic map Cross References Mapping Information D18S56 Sequence Map: Chr 18|Celera Map Viewer   Position: 25103653-25103859 (bp)   D18S56 Sequence Map: Chr 18|HuRef Map Viewer   Position: 25151521-25151727 (bp)   D18S56 Sequence Map: Chr 18 Map Viewer   Position: 26549501-26549707 (bp)   AFM123ya1 Genethon Map: Chr 18 Map Viewer   Position: 56.70 (cM)   AFM123ya1 Marshfield Map: Chr 18 Map Viewer   Position: 56.71 (cM)   AFM123ya1 NCBI RH Map: Chr 18 Map Viewer   Position: 366.3 (cR)   Lod score: 2.71   D18S56 Whitehead-RH Map: Chr 18 Map Viewer   Position: 266.6 (cR3000)   Lod score: P0.84   D18S56 Whitehead-YAC Map: Chr 18 Map Viewer   Reference Interval: WC18.2 Electronic PCR results Genomic (5 of 9)[Show All Hits] Z16631.1 40 .. 236 (197 bp)   L02016.1 56 .. 256 (201 bp)   AC090506.7 118459 .. 118665 (207 bp)   CH003465.1 24008603 .. 24008809 (207 bp)   CH003513.1 28675917 .. 28676123 (207 bp)     Working Draft phase 1 (from GenBank HTGS division) (1) AP001794.3 68263 .. 68469 (207 bp)     Working Draft phase 2 (from GenBank HTGS division) (1) AC068180.3 11221 .. 11419 (199 bp)     Whole Genome Shotgun sequences (4) AADD01158558.1 45981 .. 46187 (207 bp)   AADC01134214.1 121964 .. 122170 (207 bp)   AADB02019479.1 224290 .. 224496 (207 bp)   ABBA01022521.1 407877 .. 408083 (207 bp)        Pan troglodytes Name: D18S56 Polymorphism info:   Mapping Information D18S56 Sequence Map: Chr 18 Map Viewer   Position: 26609036-26609242 (bp) Electronic PCR results Genomic (2) BV626848.1 475 .. 663 (189 bp)   CM000332.1 26609036 .. 26609242 (207 bp)     Whole Genome Shotgun sequences (2) AADA01092771.1 4714 .. 4926 (213 bp)   AACZ02176929.1 48766 .. 48972 (207 bp)

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement