PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure

Search Entrez NCBI Web site ------------- Books CloneRegistry Domains 3D Domains Gene Genome GEO GEO Datasets HomoloGene Journals MapViewer MeSH Nucleotide OMIM PMC PopSet Protein PubMed SNP Structure Taxonomy UniGene UniSTS for

Entrez UniSTS Help Query tips Submit Submit map FTP site Statistics Related sites e-PCR Map Viewer Gene UniGene dbSNP GeneMap'99 MGD ZFIN Genomic biology Bos taurus Canis familiaris Danio rerio Homo sapiens Mus musculus Rattus novegicus Sus scrofa

UniSTS:50441 Links D12S93 Homo sapiens chromosome 12, locus SAX1, polymorphic Macaca mulatta chromosome 11 Pan troglodytes chromosome 12 Found by e-PCR in sequences from Homo sapiens and Pan troglodytes. Primer Information Forward primer: GCTGGTGGACACTGAGTTTG Reverse primer: CATCACCTCTTGTGGCTTCT PCR product size: 271-291 (bp), Homo sapiens GenBank Accession: Z16912    Homo sapiens Name: D12S93 Also known as: 205VE5 AFM205ve5 GDB:188320 HS205VE5 Polymorphism info: on genetic map Cross References Gene GeneID: 114610   Symbol: SAX1   Description: spastic ataxia 1 (autosomal dominant)   Position: 12p13 Mapping Information D12S93 Sequence Map: Chr 12|HuRef Map Viewer   Position: 5186873-5187159 (bp)   D12S93 Sequence Map: Chr 12 Map Viewer   Position: 5201115-5201393 (bp)   D12S93 Sequence Map: Chr 12|Celera Map Viewer   Position: 6951763-6952045 (bp)   D12S93 deCODE Map: Chr 12 Map Viewer   Position: 15 (cM)   AFM205ve5 Genethon Map: Chr 12 Map Viewer   Position: 13.80 (cM)   AFM205ve5 Marshfield Map: Chr 12 Map Viewer   Position: 12.60 (cM)   D12S93 Whitehead-RH Map: Chr 12 Map Viewer   Position: 59.3 (cR3000)   Lod score: P0.00   D12S93 Whitehead-YAC Map: Chr 12 Map Viewer   Reference Interval: WC12.0 Electronic PCR results Genomic (5 of 8)[Show All Hits] Z16912.1 12 .. 298 (287 bp)   AC006206.3 37194 .. 37472 (279 bp)   CH003459.1 5408490 .. 5408776 (287 bp)   CH003507.1 5243708 .. 5243991 (284 bp)   CH471116.2 5155345 .. 5155627 (283 bp)     Whole Genome Shotgun sequences (4) AADD01120983.1 15553 .. 15839 (287 bp)   AADC01103338.1 115932 .. 116215 (284 bp)   AADB02014550.1 253635 .. 253917 (283 bp)   ABBA01048755.1 257516 .. 257802 (287 bp)        Macaca mulatta Name: D12S93 Polymorphism info:   Mapping Information D12S93 Sequence Map: Chr 11 Map Viewer   Position: 5348771-5349032 (bp)   D12S93 RH Map: Chr 11 Map Viewer   Position: 43.5 (cR)   Lod score: 2.31    Pan troglodytes Name: D12S93 Polymorphism info:   Mapping Information D12S93 Sequence Map: Chr 12 Map Viewer   Position: 5405876-5406187 (bp) Electronic PCR results Genomic (1) CM000326.1 5405876 .. 5406187 (312 bp)     Whole Genome Shotgun sequences (3) AADA01325563.1 1480 .. 1799 (320 bp)   AADA01011692.1 20330 .. 20641 (312 bp)   AACZ02131623.1 50200 .. 50511 (312 bp)

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement