PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure

Search Entrez NCBI Web site ------------- Books CloneRegistry Domains 3D Domains Gene Genome GEO GEO Datasets HomoloGene Journals MapViewer MeSH Nucleotide OMIM PMC PopSet Protein PubMed SNP Structure Taxonomy UniGene UniSTS for

Entrez UniSTS Help Query tips Submit Submit map FTP site Statistics Related sites e-PCR Map Viewer Gene UniGene dbSNP GeneMap'99 MGD ZFIN Genomic biology Bos taurus Canis familiaris Danio rerio Homo sapiens Mus musculus Rattus novegicus Sus scrofa

UniSTS:78583 Links D14S258 Homo sapiens chromosome 14, locus SLC8A3 Pan troglodytes chromosome 14, locus SLC8A3 Found by e-PCR in sequences from Homo sapiens and Pan troglodytes. Primer Information Forward primer: TTCCTTAGAGCCAAAGTTCTC Reverse primer: TAACTAAATGGCGAGCATTG PCR product size: 148 (bp), Homo sapiens GenBank Accession: Z23692    Homo sapiens Name: D14S258 Also known as: AFM224zf12 SHGC-1400 stSG951 Polymorphism info:   Cross References Gene GeneID: 6547   Symbol: SLC8A3   Description: solute carrier family 8 (sodium/calcium exchanger), member 3   Position: 14q24.1 Mapping Information D14S258 Sequence Map: Chr 14|Celera Map Viewer   Position: 50647150-50647297 (bp)   D14S258 Sequence Map: Chr 14|HuRef Map Viewer   Position: 50751213-50751360 (bp)   D14S258 Sequence Map: Chr 14 Map Viewer   Position: 69652765-69652916 (bp)   SHGC-1400 NCBI RH Map: Chr 14 Map Viewer   Position: 682.5 (cR)   Lod score: 2.66   SHGC-1400 TNG Map: Chr 14 Map Viewer   Position: 24667 (cR50000)   Lod score: 13.9   Reference Interval: 68   SHGC-1400 Stanford-G3 Map: Chr 14 Map Viewer   Position: 2534 (cR10000)   Lod score: F   Reference Interval: 50   AFM224zf12 GeneMap99-G3 Map: Chr 14 Map Viewer   Position: 2582 (cR10000)   Lod score: F   Reference Interval: D14S258-D14S1028   AFM224zf12 GeneMap99-GB4 Map: Chr 14 Map Viewer   Position: 174.53 (cR3000)   Lod score: F   Reference Interval: D14S258-D14S1028 Electronic PCR results Genomic (5 of 10)[Show All Hits] Z23692.1 29 .. 176 (148 bp)   AL160191.3 147371 .. 147522 (152 bp)   AF508982.1 72891 .. 73042 (152 bp)   AL954800.2 50503053 .. 50503204 (152 bp)   CH003461.1 50319335 .. 50319482 (148 bp)     Working Draft phase 1 (from GenBank HTGS division) (1) AC009607.3 77447 .. 77598 (152 bp)     Low-pass Sequence Sampling (from GenBank HTGS division) (1) AC139418.1 679 .. 826 (148 bp)     Whole Genome Shotgun sequences (4) AADD01139262.1 34655 .. 34802 (148 bp)   AADC01117942.1 276974 .. 277121 (148 bp)   AADB02016087.1 1088657 .. 1088804 (148 bp)   ABBA01030823.1 22389 .. 22536 (148 bp)        Pan troglodytes Name: D14S258 Polymorphism info:   Cross References Gene GeneID: 467491   Symbol: SLC8A3   Description: solute carrier family 8 (sodium/calcium exchanger), member 3   Position:   Mapping Information D14S258 Sequence Map: Chr 14 Map Viewer   Position: 69738547-69738671 (bp) Electronic PCR results Genomic (1) CM000328.1 69738547 .. 69738671 (125 bp)     Whole Genome Shotgun sequences (2) AADA01109047.1 4790 .. 4914 (125 bp)   AACZ02149727.1 6692 .. 6816 (125 bp)

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement