PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure

Search Entrez NCBI Web site ------------- Books CloneRegistry Domains 3D Domains Gene Genome GEO GEO Datasets HomoloGene Journals MapViewer MeSH Nucleotide OMIM PMC PopSet Protein PubMed SNP Structure Taxonomy UniGene UniSTS for

Entrez UniSTS Help Query tips Submit Submit map FTP site Statistics Related sites e-PCR Map Viewer Gene UniGene dbSNP GeneMap'99 MGD ZFIN Genomic biology Bos taurus Canis familiaris Danio rerio Homo sapiens Mus musculus Rattus novegicus Sus scrofa

UniSTS:60216 Links D9S15 Homo sapiens chromosome 9, locus PTAR1, polymorphic Pan troglodytes chromosome 9, locus PTAR1 Found by e-PCR in sequences from Homo sapiens and Pan troglodytes. Primer Information Forward primer: TAAAGATTGGGAGTCAAGTA Reverse primer: TTCACTTGATGGTGGTAATC PCR product size: 132-197 (bp), Homo sapiens    Homo sapiens Name: D9S15 Also known as: GDB:176285 SHGC-6959 Polymorphism info: on genetic map Cross References Gene GeneID: 375743   Symbol: PTAR1   Description: protein prenyltransferase alpha subunit repeat containing 1   Position: 9q21.11 UniGene Hs.663503 Transcribed locus Mapping Information D9S15 Sequence Map: Chr 9|HuRef Map Viewer   Position: 42181045-42181242 (bp)   D9S15 Sequence Map: Chr 9|Celera Map Viewer   Position: 42932226-42932423 (bp)   D9S15 Sequence Map: Chr 9 Map Viewer   Position: 71531672-71531871 (bp)   D9S15 deCODE Map: Chr 9 Map Viewer   Position: 66.45 (cM)   D9S15 Marshfield Map: Chr 9 Map Viewer   Position: 67.93 (cM)   SHGC-6959 Stanford-G3 Map: Chr 9 Map Viewer   Position: 1973 (cR10000)   Lod score: F   Reference Interval: 14   D9S15 Whitehead-YAC Map: Chr 9 Map Viewer   Reference Interval: WC9.1 Electronic PCR results Genomic (5 of 7)[Show All Hits] AL162412.11 84106 .. 84305 (200 bp)   CH003456.1 40416764 .. 40416961 (198 bp)   CH003504.1 45472263 .. 45472460 (198 bp)   CH471089.1 1312262 .. 1312459 (198 bp)   CM000260.1 42932226 .. 42932423 (198 bp)     Working Draft phase 1 (from GenBank HTGS division) (1) AC008248.3 120751 .. 120950 (200 bp)     ESTs (3) AA535190.1 88 .. 289 (202 bp)   BI492580.1 18 .. 217 (200 bp)   CA440515.1 18 .. 199 (182 bp)     Whole Genome Shotgun sequences (4) AADD01099772.1 5122 .. 5319 (198 bp)   AADC01083379.1 198626 .. 198823 (198 bp)   AADB02012598.1 246165 .. 246362 (198 bp)   ABBA01033812.1 54134 .. 54331 (198 bp)        Pan troglodytes Name: D9S15 Polymorphism info:   Cross References Gene GeneID: 472948   Symbol: PTAR1   Description: protein prenyltransferase alpha subunit repeat containing 1   Position:   Mapping Information D9S15 Sequence Map: Chr 9 Map Viewer   Position: 68488117-68488307 (bp) Electronic PCR results Genomic (1) CM000323.1 68488117 .. 68488307 (191 bp)     Whole Genome Shotgun sequences (2) AADA01068109.1 26800 .. 26990 (191 bp)   AACZ02104140.1 18579 .. 18769 (191 bp)

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement