PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure

Search Entrez NCBI Web site ------------- Books CloneRegistry Domains 3D Domains Gene Genome GEO GEO Datasets HomoloGene Journals MapViewer MeSH Nucleotide OMIM PMC PopSet Protein PubMed SNP Structure Taxonomy UniGene UniSTS for

Entrez UniSTS Help Query tips Submit Submit map FTP site Statistics Related sites e-PCR Map Viewer Gene UniGene dbSNP GeneMap'99 MGD ZFIN Genomic biology Bos taurus Canis familiaris Danio rerio Homo sapiens Mus musculus Rattus novegicus Sus scrofa

UniSTS:11095 Links RH12084 Homo sapiens chromosome 11, locus CHID1 Macaca mulatta chromosome 14, locus LOC701435 Pan troglodytes chromosome 11, locus CHID1 Found by e-PCR in sequences from Homo sapiens and Pan troglodytes. Primer Information Forward primer: AGAAAAGAACACGTCCACCG Reverse primer: CGTCTTCTACCCAACCCTGA PCR product size: 160 (bp), Homo sapiens    Homo sapiens Name: RH12084 Also known as: stSG2719 Polymorphism info:   Cross References Gene GeneID: 66005   Symbol: CHID1   Description: chitinase domain containing 1   Position: 11p15.5 UniGene Hs.144468 Chitinase domain containing 1 Mapping Information RH12084 Sequence Map: Chr 11|HuRef Map Viewer   Position: 685024-685347 (bp)   RH12084 Sequence Map: Chr 11 Map Viewer   Position: 859819-860142 (bp)   RH12084 Sequence Map: Chr 11|Celera Map Viewer   Position: 936898-937220 (bp)   stSG2719 NCBI RH Map: Chr 11 Map Viewer   Position: 10 (cR)   Lod score: 1.07   stSG2719 GeneMap99-GB4 Map: Chr 11 Map Viewer   Position: 22.62 (cR3000)   Lod score: 0.01   Reference Interval: pTEL-D11S1318 Electronic PCR results RefSeq mRNA (1) NM_023947.2 1154 .. 1313 (160 bp)     mRNA (5 of 10)[Show All Hits] AF212229.1 1243 .. 1402 (160 bp)   AK027711.1 1154 .. 1313 (160 bp)   BC013642.1 841 .. 1000 (160 bp)   AK075413.1 1216 .. 1375 (160 bp)   BC000001.2 1229 .. 1388 (160 bp)     Genomic (5 of 7)[Show All Hits] AC132936.9 68554 .. 68877 (324 bp)   AP006623.1 51036 .. 51359 (324 bp)   CH003458.1 825285 .. 825607 (323 bp)   CH471158.1 516654 .. 516976 (323 bp)   CM000262.1 936898 .. 937220 (323 bp)     Working Draft phase 2 (from GenBank HTGS division) (1) AC138186.3 193502 .. 193825 (324 bp)     Low-pass Sequence Sampling (from GenBank HTGS division) (1) AC138276.1 12552 .. 12875 (324 bp)     ESTs (5 of 94)[Show All Hits] Z40243.1 56 .. 215 (160 bp)   T58875.1 55 .. 213 (159 bp)   R37361.1 68 .. 227 (160 bp)   N52277.1 59 .. 217 (159 bp)   N53936.1 48 .. 206 (159 bp)     Whole Genome Shotgun sequences (3) AADD01112339.1 4326 .. 4648 (323 bp)   AADB02013472.1 2 .. 324 (323 bp)   ABBA01015214.1 20204 .. 20527 (324 bp)        Macaca fascicularis   Polymorphism info:   Cross References UniGene Mfa.8081 Macaca fascicularis brain cDNA clone: QflA-22813, similar to human hypotheti...    Macaca mulatta Name: RH12084 Polymorphism info:   Cross References Gene GeneID: 701435   Symbol: LOC701435   Description: similar to CG8460-PA   Position:   UniGene Mmu.13994 Similar to CG8460-PA Mapping Information RH12084 Sequence Map: Chr 14 Map Viewer   Position: 681394-681725 (bp)    Pan troglodytes Name: RH12084 Polymorphism info:   Cross References Gene GeneID: 740654   Symbol: CHID1   Description: chitinase domain containing 1   Position:   Mapping Information RH12084 Sequence Map: Chr 11 Map Viewer   Position: 941111-941434 (bp) Electronic PCR results RefSeq mRNA (5 of 8)[Show All Hits] XM_001151593.1 1243 .. 1402 (160 bp)   XM_001152026.1 1779 .. 1938 (160 bp)   XM_001151657.1 1385 .. 1544 (160 bp)   XM_001151714.1 1248 .. 1407 (160 bp)   XM_001151781.1 1625 .. 1784 (160 bp)     Genomic (1) CM000325.1 941111 .. 941434 (324 bp)     Whole Genome Shotgun sequences (2) AADA01306036.1 331 .. 654 (324 bp)   AACZ02121681.1 343 .. 666 (324 bp)

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement