PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure

Search Entrez NCBI Web site ------------- Books CloneRegistry Domains 3D Domains Gene Genome GEO GEO Datasets HomoloGene Journals MapViewer MeSH Nucleotide OMIM PMC PopSet Protein PubMed SNP Structure Taxonomy UniGene UniSTS for

Entrez UniSTS Help Query tips Submit Submit map FTP site Statistics Related sites e-PCR Map Viewer Gene UniGene dbSNP GeneMap'99 MGD ZFIN Genomic biology Bos taurus Canis familiaris Danio rerio Homo sapiens Mus musculus Rattus novegicus Sus scrofa

UniSTS:16550 Links D12S2132 Homo sapiens chromosome 12, locus PIK3C2G Pan troglodytes chromosome 12, locus PIK3C2G Found by e-PCR in sequences from Homo sapiens and Pan troglodytes. Primer Information Forward primer: AGTGGGGAAGGAAGCTCAAT Reverse primer: TCTTCATGTTCACAGAAGCTTAGG PCR product size: 134 (bp), Homo sapiens GenBank Accession: G15310 T66837    Homo sapiens Name: D12S2132 Also known as: GDB:740849 SHGC-15979 Polymorphism info:   Cross References Gene GeneID: 5288   Symbol: PIK3C2G   Description: phosphoinositide-3-kinase, class 2, gamma polypeptide   Position: 12p12 UniGene Hs.687332 Transcribed locus Mapping Information D12S2132 Sequence Map: Chr 12|HuRef Map Viewer   Position: 18403538-18403671 (bp)   D12S2132 Sequence Map: Chr 12 Map Viewer   Position: 18526851-18526984 (bp)   D12S2132 Sequence Map: Chr 12|Celera Map Viewer   Position: 23781087-23781220 (bp)   SHGC-15979 NCBI RH Map: Chr 12 Map Viewer   Position: 210.4 (cR)   Lod score: 1.35   SHGC-15979 Stanford-G3 Map: Chr 12 Map Viewer   Position: 983 (cR10000)   Lod score: F   Reference Interval: 24   SHGC-15979 GeneMap99-G3 Map: Chr 12 Map Viewer   Position: 983 (cR10000)   Lod score: F   Reference Interval: D12S358-D12S1596 Electronic PCR results Genomic (5 of 8)[Show All Hits] G15310.1 75 .. 208 (134 bp)   AC087236.11 28997 .. 29130 (134 bp)   CH003459.1 22190751 .. 22190884 (134 bp)   CH003507.1 19458358 .. 19458491 (134 bp)   CH471094.1 8895771 .. 8895904 (134 bp)     Working Draft phase 1 (from GenBank HTGS division) (1) AC016899.4 160102 .. 160235 (134 bp)     ESTs (3) T66837.1 75 .. 208 (134 bp)   H59108.1 75 .. 208 (134 bp)   BX101890.1 334 .. 467 (134 bp)     Whole Genome Shotgun sequences (4) AADD01122171.1 6611 .. 6744 (134 bp)   AADC01104106.1 30689 .. 30822 (134 bp)   AADB02014704.1 34196 .. 34329 (134 bp)   ABBA01067922.1 439024 .. 439157 (134 bp)        Pan troglodytes Name: D12S2132 Polymorphism info:   Cross References Gene GeneID: 465321   Symbol: PIK3C2G   Description: similar to PI3-kinase   Position:   Mapping Information D12S2132 Sequence Map: Chr 12 Map Viewer   Position: 18992503-18992636 (bp) Electronic PCR results Genomic (1) CM000326.1 18992503 .. 18992636 (134 bp)     Whole Genome Shotgun sequences (2) AADA01267262.1 14174 .. 14307 (134 bp)   AACZ02132517.1 12045 .. 12178 (134 bp)

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement