refSNP ID: rs3179240 Organism: human (Homo sapiens) Molecule Type: cDNA Created/Updated in build: 105/129 Map to Genome Build: 36.3 Allele Variation Class: SNP: single nucleotide polymorphism RefSNP Alleles: A/T Ancestral Allele: Not available Clinical Association: unknown HGVS Names NM_001002231.1:c.*827T>A NM_005551.3:c.*676T>A NT_011109.15:g.23650681T>A Links SNP Details are organized in the following sections: Submission Fasta Resource GeneView Map Diversity Validation   Submitter records for this RefSNP Cluster The submission ss4399196 has the longest flanking sequence of all cluster members and was used to instantiate sequence for rs3179240 during BLAST analysis for the current build. NCBI Assay ID Handle|Submitter ID Validation Status ss to rs Orientation /Strand Alleles 5' Near Seq 30 bp 3' Near Seq 30 bp Entry Date Update Date Build Added Molecule Type Freq Warning Ancestral Allele Success Rate ss4399196 LEE|ge828910 fwd/B A/T acagaaataaagagctatcatgctgtggtt attatggtttgttacattgataggatacat 04/25/02 10/10/03 105 cDNA unknown   Fasta sequence   (Legend) >gnl|dbSNP|rs3179240|allelePos=51|totalLen=101|taxid=9606|snpclass=1|alleles='A/T'|mol=cDNA|build=105 ATGATTTCCT AGCAGGACTT ACAGAAATAA AGAGCTATCA TGCTGTGGTT W ATTATGGTTT GTTACATTGA TAGGATACAT ACTGAAATCA GCAAACAAAA   GeneView GeneView via analysis of contig annotation: KLK2 kallikrein-related peptidase 2 View variations for gene: Include clinically associated: in gene region cSNP has frequency double hit Group Label Contig->mRNA Gene Model (contig mRNA transcript) Color Legend reference NT_011109->NM_001002231 sv function reference NT_011109->NM_005551 sv function HuRef NW_001838498->NM_001002231 sv function HuRef NW_001838498->NM_005551 sv function Celera NW_927284->NM_001002231 sv function Celera NW_927284->NM_005551 sv function " Group label Contig-->mRNA-->Protein Contig position mRNA orientation mRNA pos Function dbSNP allele Protein residue Codon pos Amino acid pos reference NT_011109->NM_001002231-> 23650681 forward 1540 3' UTR reference NT_011109->NM_005551-> 23650681 forward 1503 3' UTR HuRef NW_001838498->NM_001002231-> 4548520 reverse 1540 3' UTR HuRef NW_001838498->NM_005551-> 4548520 reverse 1503 3' UTR Celera NW_927284->NM_001002231-> 740849 forward 1540 3' UTR Celera NW_927284->NM_005551-> 740849 forward 1503 3' UTR GeneView: no link established by BLAST analysis of mRNA sequences   Integrated Maps: NCBI MapViewer:  rs3179240 maps exactly once on NCBI human chromosome 19 Chromosome Contig accession Contig position Chromosome position Hit orientation Contig Allele Assembly Type Group label Contig label Neighbor SNP SNP_flank position 19 NW_001838498.2 4548520 47717386 minus A alt_assembly_8 HuRef HuRef view 50 19 NW_927284.1 740849 48433565 plus T alt_assembly_1 Celera Celera view 50 19 NT_011109.15 23650681 56074303 plus T ref_assembly reference reference view 50   NCBI Resource Links Submitter-Referenced GenBank AA579001 Hs.181350 dbSNP Blast Analysis GenBank HTGS Finished: GenBank HTGS Draft: AC037199.2 NC_000019.8 AC027602.4   Population Diversity There is no frequency data.   Validation Summary: Validation status Marker displays Mendelian segregation PCR results confirmed in multiple reactions Homozygotes detected in individual genotype data UNKNOWN UNKNOWN UNKNOWN

GENERAL: Contact Us | Homepage | Announcements |dbSNP Summary | Genome | FTP SERVER | Build History | Handle Request
DOCUMENTATION: FAQ | Searchable FAQ Archive | Overview | How to Submit | RefSNP Summary Info | Database Schema
SEARCH: Entrez SNP | Blast SNP | Batch Query | By Submitter |New Batches | Method | Population | Publication | Batch | Locus Info | Between Marker
HAPLOTYPE:Submission | Specifications | Sample HapSet | Sample Individual
NCBI: PubMed | Entrez | BLAST | OMIM | Taxonomy | Structure

Disclaimer     Privacy statement

Revised: May 25, 2006 1:38 PM .