refSNP ID: rs3758521 Organism: human (Homo sapiens) Molecule Type: Genomic Created/Updated in build: 107/129 Map to Genome Build: 36.3 Allele Variation Class: SNP: single nucleotide polymorphism RefSNP Alleles: C/T Ancestral Allele: C Clinical Association: unknown HGVS Names NM_015045.2:c.1644+11276G>A NT_030059.12:g.6994198C>T Links , Linkout SNP Details are organized in the following sections: Submission Fasta Resource GeneView Map Diversity Validation   Submitter records for this RefSNP Cluster The submission ss4944553 has the longest flanking sequence of all cluster members and was used to instantiate sequence for rs3758521 during BLAST analysis for the current build. NCBI Assay ID Handle|Submitter ID Validation Status ss to rs Orientation /Strand Alleles 5' Near Seq 30 bp 3' Near Seq 30 bp Entry Date Update Date Build Added Molecule Type Freq Warning Ancestral Allele Success Rate ss4944553 YUSUKE|IMS-JST111834 fwd/B C/T aaacaatgatgaaaaaaagccaactaaaac gactccctctcttccatacctaggcccagc 08/01/02 10/10/03 107 Genomic unknown ss66241719 AFFY|SNP_A-4271247 fwd/B C/T aaaagccaactaaaac gactccctctcttcca 10/27/06 03/31/08 127 Genomic unknown ss75125349 ILLUMINA|ILMN_Human_1M_rs3758521 fwd/B C/T aaacaatgatgaaaaaaagccaactaaaac gactccctctcttccatacctaggcccagc 08/28/07 08/29/07 129 Genomic unknown ss76387503 AFFY|AFFY_6_1M_SNP_A-4271247 fwd/B C/T aaaagccaactaaaac gactccctctcttcca 08/28/07 08/30/07 129 Genomic unknown   Fasta sequence   (Legend) >gnl|dbSNP|rs3758521|allelePos=61|totalLen=121|taxid=9606|snpclass=1|alleles='C/T'|mol=Genomic|build=129 AGTGAAAGTC ATGTAGTAAA CACCAAACAA AAACAATGAT GAAAAAAAGC CAACTAAAAC Y GACTCCCTCT CTTCCATACC TAGGCCCAGC CAGAACCTGC TCAGCTTCAA CAACTCTTTG   GeneView GeneView via analysis of contig annotation: WAPAL wings apart-like homolog (Drosophila) View variations for gene: Include clinically associated: in gene region cSNP has frequency double hit Group Label Contig->mRNA Gene Model (contig mRNA transcript) Color Legend reference NT_030059->NM_015045 sv function HuRef NW_001837992->NM_015045 sv function Celera NW_924862->NM_015045 sv function " Group label Contig-->mRNA-->Protein Contig position mRNA orientation mRNA pos Function dbSNP allele Protein residue Codon pos Amino acid pos reference NT_030059->NM_015045->NP_055860 6994198 reverse intron HuRef NW_001837992->NM_015045->NP_055860 1889376 reverse intron Celera NW_924862->NM_015045->NP_055860 7134268 reverse intron GeneView: no link established by BLAST analysis of mRNA sequences   Integrated Maps: NCBI MapViewer:  rs3758521 maps exactly once on NCBI human chromosome 10 Chromosome Contig accession Contig position Chromosome position Hit orientation Contig Allele Assembly Type Group label Contig label Neighbor SNP SNP_flank position 10 NW_001837992.1 1889376 82096579 plus C alt_assembly_8 HuRef HuRef view 60 10 NW_924862.1 7134268 82244508 plus C alt_assembly_1 Celera Celera view 60 10 NT_030059.12 6994198 88235662 plus C ref_assembly reference reference view 60   NCBI Resource Links Submitter-Referenced GenBank NT_008793.1 dbSNP Blast Analysis GenBank HTGS Finished: GenBank HTGS Draft: AL731569.18 NC_000010.9 AC016120.5   Population Diversity Sample Ascertainment Genotype Detail Alleles ss# Population Individual Group Chrom. Sample Cnt. Source C/C C/T T/T HWP C T ss4944553 JBIC-allele 1486 AF 0.958 0.042 HapMap-CEU European 120 IG 0.867 0.133 0.584 0.933 0.067 HapMap-HCB Asian 90 IG 0.978 0.022 1.000 0.989 0.011 HapMap-JPT Asian 88 IG 0.909 0.091 0.752 0.955 0.045 HapMap-YRI Sub-Saharan African 120 IG 0.900 0.083 0.017 0.100 0.942 0.058 ss66241719 HapMap-CEU European 118 GF 0.864 0.136 0.932 0.068 HapMap-HCB Asian 90 GF 0.978 0.022 0.989 0.011 HapMap-JPT Asian 90 GF 0.889 0.111 0.944 0.056 HapMap-YRI Sub-Saharan African 120 GF 0.900 0.083 0.017 0.942 0.058 Concordant Genotype Total Sample C/C C/T T/T ss4944553 269 239 28 1 ss66241719 268 239 28 1 RefSNP Genotype Summary Total Individual C/C C/T T/T rs3758521 270 240 28 1 Discordant Genotypes: Indiviudal SampleID SubSNP(ss) Genotype Population Handle Submitter Population Submitter SampleID SampleID Alias Submission Batch NCBI ProbeID 5229 ss4944553 C/C CSHL-HAPMAP HapMap-JPT NA18992 JA18992 r23_ch10_JPT_illumina:golden_gate_1.0.0 763636 5229 ss66241719 C/T CSHL-HAPMAP HapMap-JPT NA18992 JA18992 chr10-HapMap-JPT Genotype data submitted for 270 samples from 270 individuals Individual with multiple genotypes submission: 269   Validation Summary: Validation status Marker displays Mendelian segregation PCR results confirmed in multiple reactions Homozygotes detected in individual genotype data UNKNOWN UNKNOWN UNKNOWN

GENERAL: Contact Us | Homepage | Announcements |dbSNP Summary | Genome | FTP SERVER | Build History | Handle Request
DOCUMENTATION: FAQ | Searchable FAQ Archive | Overview | How to Submit | RefSNP Summary Info | Database Schema
SEARCH: Entrez SNP | Blast SNP | Batch Query | By Submitter |New Batches | Method | Population | Publication | Batch | Locus Info | Between Marker
HAPLOTYPE:Submission | Specifications | Sample HapSet | Sample Individual
NCBI: PubMed | Entrez | BLAST | OMIM | Taxonomy | Structure

Disclaimer     Privacy statement

Revised: May 25, 2006 1:38 PM .