refSNP ID: rs1053526 Organism: human (Homo sapiens) Molecule Type: cDNA Created/Updated in build: 86/129 Map to Genome Build: 36.3 Allele Variation Class: SNP: single nucleotide polymorphism RefSNP Alleles: A/G Ancestral Allele: A Clinical Association: unknown HGVS Names NM_005187.4:c.1286A>G NM_175931.1:c.1028A>G NP_005178.4:p.E429G NP_787127.1:p.E343G NT_010542.15:g.508431T>C Links , Linkout SNP Details are organized in the following sections: Submission Fasta Resource GeneView Map Diversity Validation   Submitter records for this RefSNP Cluster The submission ss1530804 has the longest flanking sequence of all cluster members and was used to instantiate sequence for rs1053526 during BLAST analysis for the current build. NCBI Assay ID Handle|Submitter ID Validation Status ss to rs Orientation /Strand Alleles 5' Near Seq 30 bp 3' Near Seq 30 bp Entry Date Update Date Build Added Molecule Type Freq Warning Ancestral Allele Success Rate ss1530804 LEE|542467 fwd/T A/G tgctgcgcaggtgccaggaggccgaccgcg ggagctcaaccactgggcgcggcgctacag 09/13/00 10/10/03 86 cDNA unknown   Fasta sequence   (Legend) >gnl|dbSNP|rs1053526|allelePos=51|totalLen=101|taxid=9606|snpclass=1|alleles='A/G'|mol=cDNA|build=86 GACGCGGCGC TCGCTCACGG TGCTGCGCAG GTGCCAGGAG GCCGACCGCG R GGAGCTCAAC CACTGGGCGC GGCGCTACAG CGACGCCGAG GACACAAAGA   GeneView GeneView via analysis of contig annotation: CBFA2T3 core-binding factor, runt domain, alpha subunit 2; translocated to, 3 View variations for gene: Include clinically associated: in gene region cSNP has frequency double hit Group Label Contig->mRNA Gene Model (contig mRNA transcript) Color Legend reference NT_010542->NM_005187 sv function reference NT_010542->NM_175931 sv function HuRef NW_001838334->NM_005187 sv function HuRef NW_001838334->NM_175931 sv function Celera NW_926561->NM_005187 sv function Celera NW_926561->NM_175931 sv function " Group label Contig-->mRNA-->Protein Contig position mRNA orientation mRNA pos Function dbSNP allele Protein residue Codon pos Amino acid pos reference NT_010542->NM_005187->NP_005178 508432 reverse 1472 missense G Gly [G] 2 429 contig reference A Glu [E] 2 429 reference NT_010542->NM_175931->NP_787127 508432 reverse 1241 missense G Gly [G] 2 343 contig reference A Glu [E] 2 343 HuRef NW_001838334->NM_005187->NP_005178 82639 reverse 1472 missense G Gly [G] 2 429 contig reference A Glu [E] 2 429 HuRef NW_001838334->NM_175931->NP_787127 82639 reverse 1241 missense G Gly [G] 2 343 contig reference A Glu [E] 2 343 Celera NW_926561->NM_005187->NP_005178 584396 reverse 1472 missense G Gly [G] 2 429 contig reference A Glu [E] 2 429 Celera NW_926561->NM_175931->NP_787127 584396 reverse 1060 missense G Gly [G] 2 343 contig reference A Glu [E] 2 343 GeneView: no link established by BLAST analysis of mRNA sequences   Integrated Maps: NCBI MapViewer:  rs1053526 maps exactly once on NCBI human chromosome 16 Chromosome Contig accession Contig position Chromosome position Hit orientation Contig Allele Assembly Type Group label Contig label Neighbor SNP SNP_flank position 16 NW_926561.1 584396 74016406 minus T alt_assembly_1 Celera Celera view 50 16 NW_001838334.1 82639 74644975 minus T alt_assembly_8 HuRef HuRef view 50 16 NT_010542.15 508432 87475316 minus T ref_assembly reference reference view 50   NCBI Resource Links Submitter-Referenced GenBank AB010419 Hs.110099 dbSNP Blast Analysis NCBI RefSeq NM (mRNA): GenBank HTGS Finished: GenBank HTGS Draft: GenBank mRNA: NM_005187.4 NM_175931.1 AC092384.5 NC_000016.8 AC009149.5 AC136930.1 AC139487.1 AC140706.1 AB010419.1 AB010420.1 BC047019.1 BC062624.1 UniGene Cluster ID 513811   Population Diversity Sample Ascertainment Genotypes Alleles ss# Population Individual Group Chrom. Sample Cnt. Source HWP A G ss1530804 CEPH 184 AF 1.000 Summary Average Het.+/- std err: Individual Count Founders Count Individual Overlap Genotype Conflict 0 0 0 0   Validation Summary: Validation status Marker displays Mendelian segregation PCR results confirmed in multiple reactions Homozygotes detected in individual genotype data UNKNOWN UNKNOWN UNKNOWN

GENERAL: Contact Us | Homepage | Announcements |dbSNP Summary | Genome | FTP SERVER | Build History | Handle Request
DOCUMENTATION: FAQ | Searchable FAQ Archive | Overview | How to Submit | RefSNP Summary Info | Database Schema
SEARCH: Entrez SNP | Blast SNP | Batch Query | By Submitter |New Batches | Method | Population | Publication | Batch | Locus Info | Between Marker
HAPLOTYPE:Submission | Specifications | Sample HapSet | Sample Individual
NCBI: PubMed | Entrez | BLAST | OMIM | Taxonomy | Structure

Disclaimer     Privacy statement

Revised: May 25, 2006 1:38 PM .