PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure

Search Entrez NCBI Web site ------------- Books CloneRegistry Domains 3D Domains Gene Genome GEO GEO Datasets HomoloGene Journals MapViewer MeSH Nucleotide OMIM PMC PopSet Protein PubMed SNP Structure Taxonomy UniGene UniSTS for

Entrez UniSTS Help Query tips Submit Submit map FTP site Statistics Related sites e-PCR Map Viewer Gene UniGene dbSNP GeneMap'99 MGD ZFIN Genomic biology Bos taurus Canis familiaris Danio rerio Homo sapiens Mus musculus Rattus novegicus Sus scrofa

UniSTS:19001 Links D7S492 Homo sapiens chromosome 7, polymorphic Macaca mulatta chromosome 5 Pan troglodytes chromosome 7 Found by e-PCR in sequences from Homo sapiens and Pan troglodytes. Primer Information Forward primer: ATCTTGGATTTAGGGTTGGC Reverse primer: GGCTCTGCTCCATCTTCATA PCR product size: 145-155 (bp), Homo sapiens GenBank Accession: Z16704    Homo sapiens Name: D7S492 Also known as: 158XA1 AFM158xa1 GDB:188108 GDB:307750 HS158XA1 Polymorphism info: on genetic map Cross References Mapping Information D7S492 Sequence Map: Chr 7|HuRef Map Viewer   Position: 84177164-84177312 (bp)   D7S492 Sequence Map: Chr 7|Celera Map Viewer   Position: 84271407-84271555 (bp)   D7S492 Sequence Map: Chr 7|CRA_TCAGchr7v2 Map Viewer   Position: 88897874-88898022 (bp)   D7S492 Sequence Map: Chr 7 Map Viewer   Position: 89404705-89404857 (bp)   D7S492 deCODE Map: Chr 7 Map Viewer   Position: 100.97 (cM)   AFM158xa1 Genethon Map: Chr 7 Map Viewer   Position: 100.50 (cM)   AFM158xa1 Marshfield Map: Chr 7 Map Viewer   Position: 100.05 (cM)   AFM158xa1 NCBI RH Map: Chr 7 Map Viewer   Position: 1000.1 (cR)   Lod score: 3.20   D7S492 Whitehead-RH Map: Chr 7 Map Viewer   Position: 444.8 (cR3000)   Lod score: P0.00   D7S492 Whitehead-YAC Map: Chr 7 Map Viewer   Reference Interval: WC7.5 Electronic PCR results Genomic (5 of 13)[Show All Hits] Z16704.1 131 .. 279 (149 bp)   G18273.1 131 .. 279 (149 bp)   AC006155.2 75323 .. 75475 (153 bp)   BL000002.1 89106604 .. 89106756 (153 bp)   CH003454.1 84734236 .. 84734384 (149 bp)     Whole Genome Shotgun sequences (5 of 6)[Show All Hits] AADD01083355.1 10880 .. 11028 (149 bp)   AADC01069669.1 34599 .. 34747 (149 bp)   AACC02000015.1 1677387 .. 1677535 (149 bp)   AADB02154926.1 273 .. 421 (149 bp)   AADB02010682.1 222611 .. 222759 (149 bp)        Macaca mulatta Name: D7S492 Polymorphism info:   Mapping Information D7S492 Sequence Map: Chr 5 Map Viewer   Position: 20239247-20239350 (bp)    Pan troglodytes Name: D7S492 Polymorphism info:   Mapping Information D7S492 Sequence Map: Chr 7 Map Viewer   Position: 89561914-89562046 (bp) Electronic PCR results Genomic (3) AC146255.2 10479 .. 10615 (137 bp)   AC161821.4 14738 .. 14870 (133 bp)   CM000321.1 89561914 .. 89562046 (133 bp)     Whole Genome Shotgun sequences (1) AADA01260768.1 985 .. 1113 (129 bp)

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement