refSNP ID: rs34716432 Organism: human (Homo sapiens) Molecule Type: Genomic Created/Updated in build: 126/129 Map to Genome Build: 36.3 Allele Variation Class: SNP: single nucleotide polymorphism RefSNP Alleles: A/G Ancestral Allele: Not available Clinical Association: unknown HGVS Names NM_002125.3:c.98G>A NP_002116.2:p.R33Q NT_007592.14:g.23356153C>T Links SNP Details are organized in the following sections: Submission Fasta Resource GeneView Map Diversity Validation   Submitter records for this RefSNP Cluster The submission ss50399829 has the longest flanking sequence of all cluster members and was used to instantiate sequence for rs34716432 during BLAST analysis for the current build. NCBI Assay ID Handle|Submitter ID Validation Status ss to rs Orientation /Strand Alleles 5' Near Seq 30 bp 3' Near Seq 30 bp Entry Date Update Date Build Added Molecule Type Freq Warning Ancestral Allele Success Rate ss50399829 UWGC|HLA-118885 fwd/T A/G gctccccactggctttggctggggacacca acgtaagtgcacattgtgggtgctgagcta 02/02/06 11/03/06 126 Genomic unknown   Fasta sequence   (Legend) >gnl|dbSNP|rs34716432|allelePos=51|totalLen=101|taxid=9606|snpclass=1|alleles='A/G'|mol=Genomic|build=126 AGTGACACTG ATGGTGCTGA GCTCCCCACT GGCTTTGGCT GGGGACACCA R ACGTAAGTGC ACATTGTGGG TGCTGAGCTA CTATGGGGTG GGGAAAATAG   GeneView GeneView via analysis of contig annotation: HLA-DRB1 major histocompatibility complex, class II, DR beta 1 View variations for gene: Include clinically associated: in gene region cSNP has frequency double hit GeneView via analysis of contig annotation: LOC730415 hypothetical protein LOC730415 View variations for gene: Include clinically associated: in gene region cSNP has frequency double hit GeneView via analysis of contig annotation: HLA-DRB4 major histocompatibility complex, class II, DR beta 4 View variations for gene: Include clinically associated: in gene region cSNP has frequency double hit GeneView via analysis of contig annotation: HLA-DRB5 major histocompatibility complex, class II, DR beta 5 View variations for gene: Include clinically associated: in gene region cSNP has frequency double hit Group Label Contig->mRNA Gene Model (contig mRNA transcript) Color Legend c6_COX NT_113891->NM_002124 sv function HuRef NW_001838980->XM_001720834 sv function HuRef NW_001838980->XM_001720835 sv function HuRef NW_001838980->XM_001720843 sv function Celera NW_923073->XM_001124749 sv function c6_QBL NT_113896->XM_001723414 sv function c6_QBL NT_113896->XM_001723417 sv function c6_QBL NT_113896->XM_001723419 sv function reference NT_007592->NM_002125 sv function " Group label Contig-->mRNA-->Protein Contig position mRNA orientation mRNA pos Function dbSNP allele Protein residue Codon pos Amino acid pos c6_COX NT_113891->NM_002124->NP_002115 3947869 reverse 160 missense A Lys [K] 2 33 contig reference G Arg [R] 2 33 HuRef NW_001838980->XM_001720834->XP_001720886 5575104 reverse 162 missense A Lys [K] 2 33 contig reference G Arg [R] 2 33 HuRef NW_001838980->XM_001720835->XP_001720887 5575104 reverse 175 missense A Lys [K] 2 33 contig reference G Arg [R] 2 33 HuRef NW_001838980->XM_001720843->XP_001720895 5575104 reverse 162 missense A Lys [K] 2 33 contig reference G Arg [R] 2 33 Celera NW_923073->XM_001124749->XP_001124749 5572577 reverse 202 missense A Lys [K] 2 33 contig reference G Arg [R] 2 33 c6_QBL NT_113896->XM_001723414->XP_001723466 428782 reverse 202 missense A Lys [K] 2 33 contig reference G Arg [R] 2 33 c6_QBL NT_113896->XM_001723417->XP_001723469 428782 reverse 161 missense A Lys [K] 2 33 contig reference G Arg [R] 2 33 c6_QBL NT_113896->XM_001723419->XP_001723471 428782 reverse 202 missense A Lys [K] 2 33 contig reference G Arg [R] 2 33 reference NT_007592->NM_002125->NP_002116 23356154 reverse 103 missense A Gln [Q] 2 33 contig reference G Arg [R] 2 33 GeneView: no link established by BLAST analysis of mRNA sequences   Integrated Maps: NCBI MapViewer:  rs34716432 maps exactly once on NCBI human chromosome 6 Chromosome Contig accession Contig position Chromosome position Hit orientation Contig Allele Assembly Type Group label Contig label Neighbor SNP SNP_flank position 6 NW_001838980.1 5575104 32302795 minus C alt_assembly_8 HuRef HuRef view 50 6 NG_002433.1 146154 32387788 minus C alt_haplotype_7 DR53 DR53 view 50 6 NT_007592.14 23356154 32605882 minus C ref_assembly reference reference view 50 6 NT_113891.1 3947869 32636412 minus C alt_assembly_3 c6_COX c6_COX view 50 6 NT_113896.1 428782 32637277 minus C alt_assembly_4 c6_QBL c6_QBL view 50 6 NW_923073.1 5572577 34108256 minus C alt_assembly_1 Celera Celera view 50   NCBI Resource Links Submitter-Referenced GenBank AY663412 dbSNP Blast Analysis GenBank HTGS Finished: AL662842.3 AL929581.5 Z84489.1   Population Diversity Sample Ascertainment Genotype Detail Alleles ss# Population Individual Group Chrom. Sample Cnt. Source A/G G/G HWP A G ss50399829 HLA_PANEL multiple 18 IG 0.222 0.778 0.752 0.111 0.889 Summary Average Het.+/- std err: Individual Count Founders Count Individual Overlap Genotype Conflict 0.198+/-0.244 10 10 0 0   Validation Summary: Validation status Marker displays Mendelian segregation PCR results confirmed in multiple reactions Homozygotes detected in individual genotype data UNKNOWN UNKNOWN UNKNOWN

GENERAL: Contact Us | Homepage | Announcements |dbSNP Summary | Genome | FTP SERVER | Build History | Handle Request
DOCUMENTATION: FAQ | Searchable FAQ Archive | Overview | How to Submit | RefSNP Summary Info | Database Schema
SEARCH: Entrez SNP | Blast SNP | Batch Query | By Submitter |New Batches | Method | Population | Publication | Batch | Locus Info | Between Marker
HAPLOTYPE:Submission | Specifications | Sample HapSet | Sample Individual
NCBI: PubMed | Entrez | BLAST | OMIM | Taxonomy | Structure

Disclaimer     Privacy statement

Revised: May 25, 2006 1:38 PM .