PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure

Search Entrez NCBI Web site ------------- Books CloneRegistry Domains 3D Domains Gene Genome GEO GEO Datasets HomoloGene Journals MapViewer MeSH Nucleotide OMIM PMC PopSet Protein PubMed SNP Structure Taxonomy UniGene UniSTS for

Entrez UniSTS Help Query tips Submit Submit map FTP site Statistics Related sites e-PCR Map Viewer Gene UniGene dbSNP GeneMap'99 MGD ZFIN Genomic biology Bos taurus Canis familiaris Danio rerio Homo sapiens Mus musculus Rattus novegicus Sus scrofa

UniSTS:27632 Links RH18281 Homo sapiens chromosome 20, locus TOMM34 Pan troglodytes chromosome 20, locus TOMM34 Found by e-PCR in sequences from Homo sapiens and Pan troglodytes. Primer Information Forward primer: CATATTACAAAGAACTATGAAGC Reverse primer: GCACCTAAGCTGTTTAAA PCR product size: 161 (bp), Homo sapiens    Homo sapiens Name: RH18281 Also known as: A007M21 stSG9639 Polymorphism info:   Cross References Gene GeneID: 10953   Symbol: TOMM34   Description: translocase of outer mitochondrial membrane 34   Position:   UniGene Hs.517066 Translocase of outer mitochondrial membrane 34 Mapping Information RH18281 Sequence Map: Chr 20|Celera Map Viewer   Position: 40279569-40279729 (bp)   RH18281 Sequence Map: Chr 20|HuRef Map Viewer   Position: 40312616-40312776 (bp)   RH18281 Sequence Map: Chr 20 Map Viewer   Position: 43004351-43004511 (bp)   stSG9639 NCBI RH Map: Chr 20 Map Viewer   Position: 436.9 (cR)   Lod score: 2.07   stSG9639 GeneMap99-GB4 Map: Chr 20 Map Viewer   Position: 242.61 (cR3000)   Lod score: 0.51   Reference Interval: D20S96-D20S119 Electronic PCR results RefSeq mRNA (1) NM_006809.4 1723 .. 1883 (161 bp)     mRNA (5 of 7)[Show All Hits] U58970.1 1612 .. 1772 (161 bp)   AK000594.1 1642 .. 1802 (161 bp)   BC001763.1 1636 .. 1796 (161 bp)   BC014907.1 1613 .. 1773 (161 bp)   BC007423.2 1636 .. 1796 (161 bp)     Genomic (5 of 10)[Show All Hits] G26032.1 86 .. 248 (163 bp)   G27206.1 86 .. 248 (163 bp)   AL109839.11 91059 .. 91219 (161 bp)   CH003467.1 40213779 .. 40213939 (161 bp)   CH003515.1 44367586 .. 44367746 (161 bp)     ESTs (5 of 147)[Show All Hits] T90735.1 69 .. 231 (163 bp)   R39018.1 86 .. 248 (163 bp)   H03960.1 57 .. 217 (161 bp)   R83919.1 79 .. 239 (161 bp)   H48272.1 86 .. 246 (161 bp)     Whole Genome Shotgun sequences (4) AADD01169715.1 11233 .. 11393 (161 bp)   AADC01141970.1 59767 .. 59927 (161 bp)   AADB02020277.1 797055 .. 797215 (161 bp)   ABBA01052655.1 43190 .. 43350 (161 bp)        Pan troglodytes Name: RH18281 Polymorphism info:   Cross References Gene GeneID: 458274   Symbol: TOMM34   Description: translocase of outer mitochondrial membrane 34   Position:   Mapping Information RH18281 Sequence Map: Chr 20 Map Viewer   Position: 42281381-42281541 (bp) Electronic PCR results RefSeq mRNA (2) XM_001153344.1 1684 .. 1844 (161 bp)   XM_514669.2 1781 .. 1941 (161 bp)     Genomic (1) CM000334.2 42281381 .. 42281541 (161 bp)     Whole Genome Shotgun sequences (2) AADA01044170.1 23269 .. 23429 (161 bp)   AACZ02191365.1 11092 .. 11252 (161 bp)

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement