G‐protein‐coupled receptors (GPCRs), the largest family of cell‐surface molecules involved in a number of biological and pathological processes, have recently emerged as key players in carcinogenesis and cancer progression. Orphan G protein‐coupled receptors (oGPCRs) are a group of proteins lacking endogenous ligands. GPR137, one of the novel oGPCR genes, was discovered by homology screening. However, the biological role of GPR137 in cancers has not yet been discussed and is of great therapeutic interest. In this study, we knocked down GPR137 via a lentivirus system in two human pancreatic cancer cell lines BXPC‐3 and PANC‐1. Knockdown of GPR137 strongly inhibited cell proliferation and colony formation. Flow cytometry showed that cell cycle was arrested in the sub‐G1 phase and apoptotic cells were significantly increased after GPR137 knockdown. Western blotting confirmed that GPR137 silencing induced apoptosis due to cleavage of PARP (poly ADP‐ribose polymerase) and upregulation of caspase 3. Furthermore, lentivirus‐mediated overexpression of GPR137 promoted the proliferation of PANC‐1 cells, suggesting GPR137 as a potential oncogene in pancreatic cancer cells. Taken together, our results prove the importance of GPR137 as a crucial regulator in controlling cancer cell growth and apoptosis.
G‐protein‐coupled receptors (GPCRs) constitute the largest family of cell surface molecules involved in signal transduction during various biological and pathological processes. In recent years, a great number of GPCRs have shown to play a pivotal role in cancer formation and metastasis. In many cancers, the normal physiological functions of GPCRs are often hijacked by the malignant cells, so as to help them evade immune detection, proliferate autonomously, improve the oxygen and nutrient supply, and increase invasion and dissemination . Many GPCRs are aberrantly expressed in various types of malignancies and may contribute to cancer progression . PSGR, a human prostate tissue‐specific gene belonging to the GPCR family, is associated with prostate cancer development and progression . Overexpression of GPR19 confers a specific benefit for lung cancer cell proliferation through accelerating cell cycle transition . MAS‐related GPCR, member D (MRGD), is highly expressed in lung cancer and involved in tumorigenesis . GPR4 has been known to play an important role in the tube formation of vascular endothelial cells and its overexpression has been observed in multiple cancers .
Orphan G protein‐coupled receptors (oGPCRs) are a group of receptors lacking endogenous ligands, most of which were found by sequence similarity. Despite the advance of molecular biology and bioinformatics, the identification of endogenous ligands of oGPCRs has always been a challenge . GPR137 is a novel oGPCR gene discovered by homology screening that shares identity with PSGR . Increasing evidences reveals that oGPCRs are also implicated in cancer cell proliferation and migration. GPR49 has been shown to be overexpressed in human colon and ovarian primary tumors . GPR55 has been implicated in the tumorigenesis of several cancers, such as cholangiocarcinoma, breast cancer, glioblastoma, prostate cancer, and ovarian cancer, suggesting it as a potential target for cancer therapy .
To date, little is known about the biological role of GPR137 in human cancers, including pancreatic cancer. In the present study, to assess the effect of GPR137 in pancreatic cancer, we used a lentivirus‐mediated RNA interference (RNAi) system to knockdown GPR137 expression in two human pancreatic cancer cell lines BXPC‐3 and PANC‐1. A variety of in vitro cellular assays provided new insights into the regulatory role of GPR137 in pancreatic cancer cell proliferation and apoptosis, which may provide a reference for the development of new therapeutic strategies for pancreatic cancer.
The short hairpin RNA (shRNA) sequence (5′‐ GAACAAAGGCTACCTGGTATTCTCGAGAATACCAGGTAGCCTTTGTTCTTTTTT‐3′) was designed to target human GPR137 gene (NM_001170726.1). It was cloned into pFH‐L vector (Shanghai Hollybio, Shanghai, People's Republic of China), which contains the green fluorescent protein (GFP) gene as a reporter. Nontargeting shRNA sequence (5′‐ CTAGCCCGGCCAAGGAAGTGCAATTGCATACTCGAGTATGCAATTGCACTTCCTTGGTTTTTTGTTAAT‐3′) was used as a control. Lentiviruses were generated by triple transfection of 80% confluent 293T cells with modified pFH‐L plasmid and pVSVG‐I and pCMV△R8.92 helper plasmids (Shanghai Hollybio) using Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA). After 72 H, lentivirus‐mediated GPR137 shRNA (Lv‐shGPR137) or control shRNA (Lv‐shCon) were collected by purification and precipitation. In addition, the pLVTHM vector (Biovector Science Lab; Beijing, China) encoding the full‐length cDNA of GPR137 was constructed. Positive colonies with inserted fragments were confirmed by DNA sequencing to generate pLVTHM‐GPR137 expression plasmid. Cells were infected with recombined lentiviruses at a multiplicity of infection of 20, and noninfected cells (Con) were used as negative controls.
Human pancreatic cancer cell lines BXPC‐3 and PANC‐1 and human embryonic kidney cell line 293T were from the Type Culture Collection of the Chinese Academy of Sciences (Shanghai, People's Republic of China). These cell lines were grown in DMEM (Dulbecco modified Eagle medium) supplemented with 10% fetal bovine serum (Hyclone; Logan, UT, USA) and maintained in a humidified incubator containing 5% CO2 at 37 °C.
Total RNA was extracted from cells using Trizol reagent (Invitrogen), and cDNA was synthesized with random primers following the manufacturer's protocol (MBI Fermantas, Vilnius, Lithuania). For quantitative real‐time PCR (qRT‐PCR), two sets of primers were used: GPR137: 5′‐ACCTGGGGAACAAAGGCTAC‐3′ (forward) and 5′‐TAGGACCGAGAGGCAAAGAC‐3′ (reverse); actin: 5′‐GTGGACATCCGCAAAGAC‐3′ (forward) and 5′‐AAAGGGTGTAACGCAACTA‐3′ (reverse). PCR reactions were performed on BioRad Connet Real‐Time PCR platform using the following system: 10 μL 2× SYBR premix ex‐taq, 0.8 μL primers, 5 μL cDNA, and 4.2 μL ddH2O. The cycling parameters were 95 °C for 30 Sec, 40 cycles of 95 °C for 5 Sec, and 60 °C for 20 Sec. All samples were repeated at least three times. The data were analyzed with the comparative threshold cycle (Ct) method (fold difference = 2–( of target gene − of reference)).
Cells were collected 5 days after lentivirus infection, washed twice with PBS (phosphate‐buffered saline), and suspended in lysis buffer (2% mercaptoethanol, 20% glycerol, 4% SDS in 100 mM Tris–HCl buffer, pH 6.8). After 15 Min of incubation on ice, the cells were disrupted by ultrasound on ice. The lysates were cleared by centrifugation (12,000g) at 4 ℃ for 15 Min. Total protein concentration was determined by the BCA protein assay. Protein (20 μg) was loaded onto a 10% SDS‐PAGE and transferred to a polyvinylidene difluoride (PVDF) membrane (Millipore; Bedford, MA, USA). Next, proteins were detected by rabbit anti‐GPR137 (11929‐1‐AP; Proteintech Group; Chicago, IL, USA), rabbit anti‐PARP (poly ADP‐ribose polymerase) (9542; Cell Signaling Technology), or rabbit anti‐caspase 3 (9661; Cell Signaling Technology; Danvers, MA, USA) using an ECL (enhanced chemiluminescence) kit (Amersham Biosciences; Piscataway, NJ, USA) and exposed to the X‐ray film. Mouse anti‐GAPDH antibody (sc‐32233; Santa Cruz, CA, USA) was used as a control to verify equal protein loading.
After infection for 4 days, BXPC‐3 and PANC‐1 cells were trypsinized and reseeded in 96‐well plates at a density of 3,000 cells per well, respectively. At indicated time points, cells were treated with methylthiazoletetrazolium (MTT) solution (5 mg/mL, 10 μL/well). After 4‐H incubation at room temperature, 150 μL of acidic isopropanol (5% isopropanol, 10% SDS, and 0.01 mol/L HCL) was added to each well to dissolve the crystals. After 10 Min at room temperature, the absorbance of plate was recorded at 595 nm.
To observe the relative long‐term inhibitory effect of Lv‐shGPR137, colony formation assay was performed on BXPC‐3 cells with three different treatments: Lv‐shGPR137, Lv‐shCon, and Con. In brief, lentivirus‐transduced BXPC‐3 cells were reseeded in 6‐well plates at a density of 900 cells/well and allowed to grow for 16 days to form natural colonies. At the end of time point, cells were washed by PBS, treated with crystal purple, and washed three times by ddH2O. Then, the colonies were photographed using a digital camera and the number of colonies was counted. All samples were repeated at least three times.
Flow cytometry with propidium iodide (PI) staining was applied to analyze the cell cycle distribution. BXPC‐3 cells with three different treatments (Lv‐shGPR137, Lv‐shCon, and Con) for 3 days were seeded in 6‐cm dishes with a density of 200,000 cells/dish. After 48 H, cells were collected for fixation and PI staining. Briefly, cells were washed with PBS, fixed with 70% cold ethanol, and suspended in PI‐containing PBS buffer (100 μg/mL PI and 10 μg/mL RNase A). After 30 Min of incubation, a fluorescence‐activated cells sorting (FACS) caliber II sorter and Cell Quest FACS system (BD Biosciences, San Jose, CA, USA) was used to conduct a flow cytometry analysis. The percentages of cells in sub‐G1, G0/G1, S, and G2/M phases were statistically analyzed.
BXPC‐3 cells were subjected to three different treatments (Lv‐shGPR137, Lv‐shCon, and Con) for 6 days. Then, cells were washed and reseeded in 6 cm dishes at a density of 70,000 cells/dish. After 96 H of incubation, the cells were collected and subjected to annexin V–APC/7‐AAD double staining according to the manufacture's instruction (KGA1026; KeyGEN Biotech, Nanjing, People's Republic of China). Flow cytometry analysis was performed on the FACS caliber II sorter and Cell Quest FACS system (BD Biosciences).
All data were expressed as the mean ± SD of three independent experiments. Statistical significance was calculated using the Student's t‐test. A P value of less than 0.05 was considered statistically significant.
All experimental research that is reported in this article has been performed with the approval of Institutional Ethics Committee of Shandong University.
To clarify the biological function of GPR137 in pancreatic cancer, a lentivirus‐mediated RNAi system was used. BXPC‐3 and PANC‐1 cells were subjected to three different treatments (Lv‐shGPR137, Lv‐shCon, and Con), and then the efficiency of infection (>80%) was detected after 72 H (Figs. A and 1B). Then, the knockdown efficiency of Lv‐shGPR137 was observed by qRT‐PCR. As shown in Figs. C and 1E, the relative expression of GPR137 in BXPC‐3 and PANC‐1 cells treated with Lv‐shGPR137 was significantly inhibited (71.6%, P < 0.01; 81.2%, P < 0.001), respectively, as compared with that in the Lv‐shCon group. To further determine that the GPR137 gene was silenced by Lv‐shGPR137, the protein levels in BXPC‐3 and PANC‐1 cells were evaluated using Western blot. As shown in Figs. D and 1F, the protein levels of GPR137 were consistently downregulated in Lv‐shGPR137 groups as compared with Lv‐shCon groups.
To further estimate the effect of Lv‐shGPR137 on pancreatic cancer cell proliferation, the MTT and colony formation assays were conducted on lentivirus‐infected BXPC‐3 and PANC‐1 cells. As shown in Fig. A, the OD (optical density) value in Lv‐shGPR137‐treated (0.415 ± 0.008) BXPC‐3 cells was significantly reduced, in contrast to Lv‐shCon (0.735 ± 0.017) or Con (0.763 ± 0.02) groups (P < 0.001) on day 4. On day 5, the inhibitory effect became more obvious in Lv‐shGPR137‐treated cells. Significant inhibition of cell proliferation was also observed in Lv‐shGPR137‐infected PANC‐1 cells, in which the count of viable cells on day 5 was decreased by 63% in comparison with the Lv‐shCon group (P < 0.001, Fig. B).
Meanwhile, the colony formation capacity of Lv‐shGPR137‐treated pancreatic cancer cells was also determined. Briefly, BXPC‐3 cells in three groups were allowed to grow for 16 days to form natural colonies. After crystal violet staining, the number of colonies was counted. Obviously, Lv‐shGPR137 infection led to the reduced number of colonies (Fig. C) and smaller size of single colony (Fig. D). Statistically, the number of colonies was decreased by over 70% in Lv‐shGPR137‐infected cells as compared with Lv‐shCon or Con groups (P < 0.001, Fig. E). Taken together, we suggest that GPR137 may play an important role in pancreatic tumorigenesis.
To further illustrate how GPR137 knockdown inhibits BXPC‐3 cell growth, we then employed a cell cycle analysis by flow cytometry. There was only a remarkable difference in the G0/G1 phase distribution in all three groups (Lv‐shGPR137, Lv‐shCon, and Con) (Figs. A and 3B). Interestingly, as shown in Fig. C, Lv‐shGPR137 strongly increased the population of cells in the sub‐G1 phase as compared with Lv‐shCon or Con groups, indicating that Lv‐shGPR137 is able to induce apoptosis in BXPC‐3 cells (P < 0.01). To further confirm the effect of GPR137 on cell apoptosis, we then applied annexin V–APC/7‐AAD double staining on BXPC‐3 cells following lentivirus infection. Annexin V–APC versus 7‐AAD plots from the gated cells showed the populations corresponding to viable (annexin V–/AAD–), necrotic (Annexin V–/7‐AAD+), early apoptotic (annexin V+/7‐AAD–), and late apoptotic (annexin V+/7‐AAD+) cells. GPR137 knockdown augmented apoptotic cells (early apoptosis and late apoptosis) by 3.6‐fold as compared with controls (Figs. A and 4B). Furthermore, the expression alterations of apoptosis markers were detected in BXPC‐3 cells, including PARP and caspase 3. Western blot showed that knockdown of GPR137 resulted in an obvious increase in PARP and caspase 3 expression (Fig. C). Hence, the above‐mentioned data reveal that GPR137 inhibition induced a strong proapoptotic effect in human pancreatic cancer BXPC‐3 cells. Thus, we may infer that GPR137 is involved in signaling pathways that mediate pancreatic cancer cell apoptosis.
As shown in Fig. S1A in the Supporting Information, more than 80% of cells presented GFP signals in Lv‐oxCon and Lv‐oxGPR137 groups, indicating a satisfying infection efficiency. Western blotting confirmed the increase in the GPR137 protein level in the Lv‐oxGPR137 group (Fig. S1B in the Supporting Information). The MTT assay showed that the overexpression of GPR137 increased the proliferation of PANC‐1 cells (P < 0.001, Fig. S1C in the Supporting Information). These data suggest that GPR137 may be an oncogene in pancreatic cancer.
GPCRs are the largest class of human membrane protein receptors, which attract much attention. Recently, there are a few reports on the role of GPCRs in pancreatic cancer. For instance, a cross‐talk between insulin/insulin‐like growth factor 1 receptors and GPCR signaling has been found in pancreatic cancer cells, which may lead to enhanced signaling, DNA synthesis, and cell proliferation . Also, a novel aspect of the cross‐talk is that insulin enhances GPCR‐induced Ca²+ signaling in a time‐ and dose‐dependent manner . However, the involvement of GPR137, which encodes an oGPCR protein, in pancreatic carcinogenesis and progression has rarely been studied.
In this study, we applied a lentivirus‐mediated RNAi system to specifically knock down the endogenous expression of GPR137 gene. Suppression of GPR137 resulted in a significant reduction in pancreatic cancer cell growth, in a short or relative long term, as determined by MTT and colony formation assays. Moreover, although GPR137 knockdown exerted a weak influence on cell cycle (G0/G1, S, G2/M phases) distribution change, it caused a significant accumulation of cells in the sub‐G1 phase representing apoptotic cells. Furthermore, flow cytometry analysis using annexin V–APC/7‐AAD was applied to confirm the effect of GPR137 on cell apoptosis. Depletion of GPR137 induced a remarkable proapoptotic effect on BXPC‐3 cells. Western blot showed that knockdown of GPR137 increased the cleavage of PARP and the expression of caspase 3, which are hallmarks of apoptosis. Therefore, we could conclude that the growth inhibition by GPR137 silencing in pancreatic cancer probably occurred because of the induction of apoptosis.
More importantly, the above data strongly suggest that GPR137 may act as an oncogene in pancreatic cancer progression, and it might be used as a pharmacological target for cancer therapy. GPCRs are the most frequent targets for drug development as evidence by the fact that approximately 50% of all prescription drugs on the market actually act on GPCRs directly or indirectly . Given the prevalence of GPCR‐targeted drugs and the role of GPR137 in pancreatic cancer, GPR137 may emerge as a potential therapeutic target in pancreatic cancer.
Our data reveal that GPR137 plays an important role in pancreatic cancer cell proliferation and apoptosis. Further investigation may help clarify the underlying regulatory mechanism. A broader investigation on GPCR and pancreatic cancers may provide us with new aspects for cancer research and drug discovery.
The authors have no financial conflict of interest.